v24

Sorry, there was a problem loading sequence from server. Please try again and contact us if the problem persists.

Homo sapiens (human) family with sequence similarity 138 member B (FAM138B) URS00003FB2BC_9606

Caution, this is an AI generated summary based on literature. This may have errors, see here for more. Please share your feedback with us.

FAM138B: FAM138B is a long non-coding RNA (lncRNA) that has been implicated in various cancers, including hepatocellular carcinoma (HCC) and lung adenocarcinoma [PMC9262158] [PMC7803541]. Studies have shown that FAM138B is involved in cellular adhesion and DNA double-strand break repair, processes relevant to cancer [PMC7696515]. In HCC, exosomes containing si-FAM138B have been found to inhibit FAM138B expression and promote miR-765 expression in HCC cells [PMC7803541]. FAM138B has also been found to be downregulated in thyroid lesions compared to normal thyroid samples [PMC4075731]. Additionally, FAM138B has been found to be positively correlated with FUBP1 expression in HCC [PMC8529087]. High expression of FAM138B has been associated with poor survival in HCC patients [PMC6854603]. However, there is a lack of direct evidence demonstrating the interaction between FAM138B and other molecules involved in HCC progression [PMC6854603]. Furthermore, the optimal panel of predictive mRNAs and lncRNAs for cancer prognosis includes FAM138B as a predictive lncRNA [PMC7822694]. In hepatocellular carcinoma, exosomal lncRNA FAM138B derived from cancer cells has shown potential as a therapeutic target by sponging miR-765 [PMC8295603]. Overall, the present study suggests that FAM138B may serve as a novel prognostic biomarker and therapeutic target for HBV-associated HCC [PMC6854603]

Genome locations

Gene Ontology annotations

Sequence

Sequence features are shown above as colored rectangles. Zoom in and click to view details, or Reset

Search for similar sequences 
CACACAACGGGGUUUCGGGGCUGUGGACCCUGUGCCAGGAAAGGAAGGGCGCAGCUCCUGCAAUGCGGAGCAGCCAGGGCAGUGGGCACCAGGCUUUAGCCUCCCUUUCUCACCCUACAGAGGGCAGGCCCUUCAGCUCCAUUCUCCUCCAAGGCUGCAGAGGGGGCAGGAAUUGGGGGUGACAGGAGAGCUGUAAGGUCUCCAGUGGGUCAUUCUGGGCCCAGAGAUGGGUGCUGAAGCUCCCACGCCUGCCUGUGAAAAUGGAGUCCUCUCUCACCUGGGAGAGCCAGGUGCUGCCCCGAGAAGGAUGCAUUUAUGGCUUCAUGAAGUCUUUCCUGACCCCCGAUGCUGCUGACUAUAGAGACAAAGUCUCACUAUGUUGCUCAGGCUGGUCUUGAACUCCUGGCCUCAAGCGAUCCUCCCACCUUAGCCUCCCAAAGAGUUGGGAUUAUAGACAUGAGCCACUGCACCUGGCCGACCUUGGGCAAGUUCUUAAACCCUUCAAAGCCUCAUUUUUCUCCAAUCAUAAAAGGGAAAGAUGGUAAUAUUUUCCCCUCCAAAUUCUUGUCGGAUGCCCUCACAGAAUUGAGAUUAUGUACGUAAAACACCAGGUGCCUAACCCGGCACAGAGCAGGAGGGCUAAGCGUGACAUCCAGCACGUGGUCAGUGGAAUCCAGUAUUCCUACCCACCUCUCUAGUCUCCCCUCCACCCCUCUCCCUUUCAGAGGCACCAAGCUGCUUGUGGUCUUGUCUAUUCCCACUCCCUGCCUGACUGAACAUUUUCUCCACCUCCUGAUCAUCAGCAGCAGAAACUGGCUGCUCUUCCUCCUGGGUAGACAGCCAGACUGUAUUUCCCAGCUGCCCCUGCAGUGAGAUGUGGCCAUCGGAGCCAGCAUUGGCCAAUGGACUCUGCAUGGGAGUGACGCAUGCUGCCUCCAGGCUUGUCCCUAAAACCUCCCACGUGUCCUCCGCCUGCUCUUCCCACUUCCAAGGAGCACGGCAAUUGUGGAAGACCCAGAUUAGUGAUGGCAGAACCAUAGAUGGGAGGAACCUGGGUCCCUGACUUAAAGUAUCAUGGAUUUGGAUGUUCCCUUAGUGAGAAAUAAACUUCCAUUGUGUUUAAGCCUUUA

Taxonomic tree

View annotations in different species by clicking on species names.

Scroll around to explore the entire tree. Click tree nodes to collapse or expand them. Hover over taxon names to display additional information.

Publications