v24

Sorry, there was a problem loading sequence from server. Please try again and contact us if the problem persists.

Homo sapiens (human) long intergenic non-protein coding RNA 1385 (LINC01385) URS00003F6648_9606

Caution, this is an AI generated summary based on literature. This may have errors, see here for more. Please share your feedback with us.

LINC01385: LINC01385 is a long non-coding RNA (lncRNA) that has been implicated in various diseases, including nasopharyngeal carcinoma (NPC) and osteoarthritis (OA). In NPC, high expression of LINC01385 is associated with poor prognosis and short overall survival [PMC7554987]. It is also considered an oncogenic lncRNA in NPC, along with other lncRNAs such as HOTTIP, HOTAIR, and XIST, which promote cell proliferation, migration, invasion, and metastasis [PMC7554987]. In OA, LINC01385 has been found to play a role in disease progression by regulating the microRNA-140-3p/TLR4 axis [PMC9499754]. Furthermore, LINC01385 has been identified as a potential therapeutic target in NPC [PMC7448472]. Additionally, the interaction between LINC01385 and various miRNAs has been implicated in regulating cancer development. For instance, miR-140-3p directly targets LINC01385 in OA tissues [PMC9570089]. These findings highlight the significance of LINC01385 as a potential biomarker and therapeutic target for diseases such as NPC and OA. Further research is needed to fully understand the mechanisms by which LINC01385 contributes to disease progression.

Genome locations

Gene Ontology annotations

Sequence

Sequence features are shown above as colored rectangles. Zoom in and click to view details, or Reset

Search for similar sequences 
GCGCCCGGGCCGGCAACUCCCUGGGAGCUCGGCCCGCGCGGGGAACUCGCCCAGCAGCCUGUGUUUCUCGAGUGUGGGCAGCCGGCUCCCGGGCGUCCCUCCCACCGGCUGCGGGGGCCCGGGACUGGGCGGUAGUGGAGGCAGGUCCUUGGACUGCAGGCUGAGGCUUUUUCCCCCCACGAGCGGUUUGGGCCCUCCAGGAGCCCCUGCGCGGGGGUCACGUGGAUUACGCUAGGUGAGAGCCGGAGAGGCUGCGCCACCGUCGGGAGGCUCCCUGCCUCCGCCCUUUGUCCUUUGCCCCUGACCAUGAGCGCCCCAAGCCCAGGGACCUCCUUAGGGGGAUGAAGGCUGGAAGAGACCUGGGGGCUCAGACUUACGGGGAAGGAACCUAGGCUAUUCCUUGUGCAUCCCAGGAUUUUACCCAUGAACGUGAACAUGAACGUGUUUUCAACCCCAGCGGUUCCCCUGGCGCCUCGACCCUCCUUUGAAGAGUCAUUCUAGAAGGCUGUAUUGCGAUAGUGUUUGUACCUGUCACUGUGAGCCCUGAAAAGAGACAGAAGAAAACGCGAGUGCCUGGCCUGAGGGUGCUCCGUCCCGUGGGUAGCCAGGGCACUCCACUUCAGCAUUCUCCUGUGGUGUAACAUUACCUGCCACUCAUGCUGGUUCCCAUGCGCCAAGCUAAUUUCAACAACGGGUGAAGUGGGUAUCUCCAUGUGAUGGCUGAGGAGACAGAUUCUGGGUGUUGCUACUAAGCCUCAUGGAGGCAGCCAUGACAGAGCA

Taxonomic tree

View annotations in different species by clicking on species names.

Scroll around to explore the entire tree. Click tree nodes to collapse or expand them. Hover over taxon names to display additional information.

Expression New Publications