Sorry, there was a problem loading sequence from server. Please try again and contact us if the problem persists.
Homo sapiens (human) RNA, U4 small nuclear 1 (RNU4-1) secondary structure diagram

Homo sapiens (human) RNA, U4 small nuclear 1 (RNU4-1) URS00003F07BD_9606

Caution, this is an AI generated summary based on literature. This may have errors, see here for more. Please share your feedback with us.

RNU4-1: RNU4-1 is a small nuclear RNA (snRNA) that has been found to be significantly present in the regulatory network of several genes, including survival-associated AS events and splicing factors [PMC9519915] [PMC7272712]. It has been observed that RNApol2 is significantly decreased at unexpected sites, such as CEBPB, and many snRNAs, including RNU4-1 [PMC6166801]. RNU4-1 has also been found to have extreme differential co-expression values with mRNA encoding ribosomal proteins and other small nuclear RNAs [PMC7236799]. However, RNU4-1 was not found in the training cohort of a study that identified several splicing factors [PMC9467413]. It has also been shown that overexpression of RPS10P2-AS1 increases the expression of RNU4-1 and other small nuclear RNAs involved in ribosomal function [PMC6804435]. In endometrial cancer, RNU4-1 has been linked to patient outcome-associated alternative splicing [PMC9803687]. Additionally, RNU4-1 has shown upregulation in higher grade tumors and tumors with receptor negative status in breast cancer patients [PMC9803687]. However, no information about the involvement of RNU4-1 in breast or other cancers was found in PubMed or the NURSA Transcriptomine database [PMC5966448]. Finally, INTS11 depletion leads to an accumulation of unprocessed RNU4-1 precursors as expected [PMC7610016].

mRNA interactions 1 total

Genome locations

Gene Ontology annotations

Sequence

Sequence features are shown above as colored rectangles. Zoom in and click to view details, or Reset

Search for similar sequences
AGCUUUGCGCAGUGGCAGUAUCGUAGCCAAUGAGGUCUAUCCGAGGCGCGAUUAUUGCUAAUUGAAAACUUUUCCCAAUACCCCGCCGUGACGACUUGCAAUAUAGUCGGCACUGGCAAUUUUUGACAGUCUCUACGGAGACUG

Taxonomic tree

View annotations in different species by clicking on species names.

Scroll around to explore the entire tree. Click tree nodes to collapse or expand them. Hover over taxon names to display additional information.

2D structure Publications