Sorry, there was a problem loading sequence from server. Please try again and contact us if the problem persists.
Homo sapiens (human) mitochondrially encoded tRNA-Phe (UUU/C) (MT-TF) secondary structure diagram

Homo sapiens (human) mitochondrially encoded tRNA-Phe (UUU/C) (MT-TF) URS00003E8921_9606

Caution, this is an AI generated summary based on literature. This may have errors, see here for more. Please share your feedback with us.

MT-TF: MT-TF is a mitochondrially encoded tRNA phenylalanine gene that is essential for protein synthesis [PMC6571852]. In a study by (77), it was found that workers with high blood chromium levels exhibited hypomethylation of MT-TF and MT-RNR1 genes [PMC9986591]. These genes play important roles in mitochondrial function and protein synthesis. The D-loop promoter, which is involved in the initiation of transcription for the entire mitochondrial genome, was also found to have lower levels of methylation in workers with high chromium exposure [PMC9986591]. The study by (77) was the first to investigate mitochondrial DNA methylation in relation to chromium exposure, providing important insights into the epigenetic effects of chromium on mitochondrial gene regulation [PMC9986591]. The findings suggest that exposure to chromium may lead to alterations in DNA methylation patterns, specifically affecting genes involved in protein synthesis and transcription initiation within mitochondria [PMC9986591]. Further research is needed to fully understand the mechanisms underlying these epigenetic changes and their potential implications for human health [PMC9986591].

Genome locations

Gene Ontology annotations

Sequence

Sequence features are shown above as colored rectangles. Zoom in and click to view details, or Reset

Search for similar sequences
GUUUAUGUAGCUUACCUCCUCAAAGCAAUACACUGAAAAUGUUUAGACGGGCUCACAUCACCCCAUAAACA

Taxonomic tree

View annotations in different species by clicking on species names.

Scroll around to explore the entire tree. Click tree nodes to collapse or expand them. Hover over taxon names to display additional information.

This sequence is found in 3 other species

  1. Cloning vector pRS316-1B9 tRNA-Phe
  2. Homo heidelbergensis tRNA-Phe
  3. Homo sapiens neanderthalensis neanderthalensis transfer RNA-Phe
2D structure Publications