Sorry, there was a problem loading sequence from server. Please try again and contact us if the problem persists.
Homo sapiens (human) small nucleolar RNA, H/ACA box 52 (SNORA52) secondary structure diagram

Homo sapiens (human) small nucleolar RNA, H/ACA box 52 (SNORA52) URS00003E7565_9606

Caution, this is an AI generated summary based on literature. This may have errors, see here for more. Please share your feedback with us.

SNORA52: SNORA52 is a small nucleolar RNA (snoRNA) belonging to the H/ACA box snoRNA family. H/ACA box snoRNAs, including SNORA52, are known to modulate rRNA-related functions through pseudouridylation [PMC8203349]. Abnormal rRNA pseudouridylation has been linked to the promotion of oncogenesis [PMC8203349]. A study compared two subgroups of SNORA52 and found qualitative differences in various clinical characteristics [PMC8203349]. The study also assessed the relationship between SNORA52 expression and overall survival in hepatocellular carcinoma (HCC) patients and found a significant association between SNORA52 expression and malignancy of HCC lesions [PMC8203349]. The downregulation of SNORA52 in HCC was confirmed through validation using cell lines and clinical specimens [PMC8203349]. However, the exact mechanisms underlying the relationship between SNORA52 and HCC remain unknown [PMC8203349]. Univariate Cox regression analysis showed that SNORA52 expression was significantly associated with overall survival in HCC patients, along with other clinical variables such as tumor size, tumor number, capsular invasion, vessel carcinoma embolus, and TNM stage [PMC8203349]. The downregulation of SNORA52 in HCC tissues compared to adjacent liver tissues was also observed [PMC8203349]. The study suggested that downregulated SNORA52 could lead to dysfunction of tumor suppressor rRNAs or ribosomes, promoting oncogenesis and development of HCC [PMC8203349]. [References: PMC8203349]

Genome locations

Gene Ontology annotations

Sequence

Sequence features are shown above as colored rectangles. Zoom in and click to view details, or Reset

Search for similar sequences
UGGUCCAUCCUAAUCCCUGCCGGUCCAUCUGUGGCCUGCCAGGUUUCGCUUGUGGACCAGAGCACCCUAGAAGCCUCACCCGAGGAGUGAGCAGGGCUCCAGUGGGCUCACGUCAUGGGCACUUCUAGACACUC

Taxonomic tree

View annotations in different species by clicking on species names.

Scroll around to explore the entire tree. Click tree nodes to collapse or expand them. Hover over taxon names to display additional information.

2D structure Publications