Sorry, there was a problem loading sequence from server. Please try again and contact us if the problem persists.

Homo sapiens (human) hsa-miR-1197 URS00003E5E03_9606

Caution, this is an AI generated summary based on literature. This may have errors, see here for more. Please share your feedback with us.

hsa-mir-1197: Hsa-mir-1197 is a microRNA that has been studied in various contexts [PMC5710922]. It has been found to have a similar expression profile to RNA-seq findings [PMC5710922] and its expression has been validated in blood samples of patients and healthy controls [PMC5710922]. Differential expression of hsa-mir-1197 has been observed in patients compared to healthy controls [PMC5710922]. Hsa-mir-1197 is one of the hub miRNAs in a ceRNA network and its expression level is lower in patients with lung cancer compared to normal controls [PMC5710922]. It has also been identified as one of the miRNAs downstream of hsa_circ_0006091 [PMC8973770]. Bioinformatics analysis suggests that hsa-mir-1197 may be involved in post-transcriptional regulation and can bind to the 3'-UTR of RIPK1 [PMC7191703]. The rs17548629 C>T variant can affect the binding strength between hsa-mir-1197 and RIPK1 [PMC7191703]. Hsa-mir-1197 has also been found to be associated with inhibiting virus replication, such as SARS-CoV-2 replication [PMC8890551]. It is targeted by other miRNAs, such as hsa-miR-520h, hsa-miR-1298, and hsa-miR 520g [PMC8483823]. Hsa-mir-1197 has also been associated with cancer progression, including bladder cancer, lung cancer, and prostate cancer [PMC8414803]. Overall, hsa-mir-1197 plays a role in various biological processes and its dysregulation may have implications for disease development [PMC8414803].

Genome locations

Gene Ontology annotations

Sequence

Sequence features are shown above as colored rectangles. Zoom in and click to view details, or Reset

Search for similar sequences
UAGGACACAUGGUCUACUUCU

Taxonomic tree

View annotations in different species by clicking on species names.

Scroll around to explore the entire tree. Click tree nodes to collapse or expand them. Hover over taxon names to display additional information.

This sequence is found in 14 other species

  1. Bos taurus bta-miR-1197
  2. Canis lupus familiaris Cfa-Mir-154-P30_3p (mature (guide))
  3. Capra hircus (goat) chi-miR-1197-3p
  4. Cavia porcellus cpo-miR-1197-3p
  5. Dasypus novemcinctus dno-miR-1197-3p
  6. Echinops telfairi Ete-Mir-154-P30_3p (mature (guide))
  7. Equus caballus (horse) eca-miR-1197
  8. Macaca mulatta Mml-Mir-154-P30_3p (mature (guide))
  9. Mus musculus (house mouse) mmu-miR-1197-3p
  10. Oryctolagus cuniculus (rabbit) ocu-miR-1197-3p
  11. Ovis aries oar-miR-1197-3p
  12. Pan troglodytes ptr-miR-1197
  13. Pongo pygmaeus ppy-miR-1197
  14. Rattus norvegicus Rno-Mir-154-P30_3p (mature (guide))
Publications