Sorry, there was a problem loading sequence from server. Please try again and contact us if the problem persists.

Homo sapiens (human) hsa-miR-365b-5p URS00003E2232_9606

Caution, this is an AI generated summary based on literature. This may have errors, see here for more. Please share your feedback with us.

hsa-mir-365b: Hsa-mir-365b is a microRNA species that was found to be upregulated at both timepoints in monocytes, suggesting its role as a steady regulator of the inflammatory response [PMC6433273]. However, qRT-PCR analysis did not confirm the upregulation of hsa-mir-365b at either timepoint [PMC6433273]. In the context of breast cancer, hsa-mir-365b was identified as one of the miRNAs that interacted with breast cancer genes associated with tumor metastasis and molecular subtypes [PMC5549916]. Additionally, hsa-mir-365b was found to be one of the miRNAs that intersected between two models in a study involving genes, methylation-related genes, and miRNAs [PMC8196729]. Overall, these findings suggest that hsa-mir-365b may have important regulatory roles in both inflammatory responses and breast cancer progression. However, further research is needed to fully understand its specific functions and mechanisms.

Genome locations

Gene Ontology annotations

Sequence

Sequence features are shown above as colored rectangles. Zoom in and click to view details, or Reset

Search for similar sequences
AGGGACUUUCAGGGGCAGCUGU

Taxonomic tree

View annotations in different species by clicking on species names.

Scroll around to explore the entire tree. Click tree nodes to collapse or expand them. Hover over taxon names to display additional information.

This sequence is found in 3 other species

  1. Alligator mississippiensis ami-miR-365-2-5p
  2. Columba livia cli-miR-365-2-5p
  3. Mus musculus (house mouse) Mus_musculus piRNA piR-mmu-33888744
Publications