Sorry, there was a problem loading sequence from server. Please try again and contact us if the problem persists.

Homo sapiens (human) hsa-miR-331-3p URS00003DDE27_9606

Caution, this is an AI generated summary based on literature. This may have errors, see here for more. Please share your feedback with us.

hsa-mir-331: Hsa-mir-331 is a microRNA that has been studied in various contexts. It has been used as an endogenous control in quantitative PCR experiments [PMC5386650]. Prediction analysis based on TargetScan revealed that hsa-mir-331 has binding sites for multiple miRNAs [PMC7497355]. Hsa-mir-331 has also been detected in follicular fluid samples [PMC6242846]. It is highly expressed in certain conditions, such as sRNAs associated with tumorigenesis and poor prognosis in hepatocellular carcinoma [PMC7797118] and liver cancer tsRNA [PMC8843861]. Hsa-mir-331 is also involved in regulating gene expression and cell migration, such as inhibiting glioblastoma cell migration and interfering with cisplatin resistance in hepatocellular carcinoma cells [PMC8843861] [PMC9816852]. Additionally, hsa-mir-331 has been found to be differentially expressed in various diseases, including psoriasis, neuroblastoma, and medulloblastoma [PMC3110257] [PMC5206712] [PMC9278893]. It is part of prognostic models for neuroblastoma and is associated with overall survival rates of patients with neuroblastoma [PMC9278893]. Hsa-mir-331 expression levels have also been linked to prognosis, with higher expression levels associated with a good prognosis for neuroblastoma patients.

mRNA interactions 1 total

Genome locations

Gene Ontology annotations

Localisation

Sequence

Sequence features are shown above as colored rectangles. Zoom in and click to view details, or Reset

Search for similar sequences
GCCCCUGGGCCUAUCCUAGAA

Taxonomic tree

View annotations in different species by clicking on species names.

Scroll around to explore the entire tree. Click tree nodes to collapse or expand them. Hover over taxon names to display additional information.

This sequence is found in 15 other species

  1. Artibeus jamaicensis aja-miR-331
  2. Bos taurus bta-miR-331-3p
  3. Canis lupus familiaris (dog) cfa-miR-331
  4. Cavia porcellus cpo-miR-331-3p
  5. Cervus elaphus (red deer) cel-miR-331
  6. Dasypus novemcinctus (nine-banded armadillo) dno-miR-331-3p
  7. Echinops telfairi (small Madagascar hedgehog) Ete-Mir-331_3p (mature (guide))
  8. Equus caballus eca-miR-331
  9. Macaca mulatta mml-miR-331-3p
  10. Mus musculus (house mouse) mmu-miR-331-3p
  11. Oryctolagus cuniculus ocu-miR-331-3p
  12. Pan troglodytes ptr-miR-331
  13. Pteropus alecto pal-miR-331-3p
  14. Rattus norvegicus (Norway rat) rno-miR-331-3p
  15. Sus scrofa ssc-miR-331-3p
Publications