Sorry, there was a problem loading sequence from server. Please try again and contact us if the problem persists.
Homo sapiens let-7g stem-loop (hsa-let-7g) secondary structure diagram

Homo sapiens let-7g stem-loop (hsa-let-7g) URS00003DBD40_9606

Caution, this is an AI generated summary based on literature. This may have errors, see here for more. Please share your feedback with us.

MIRLET7G: MIRLET7G is a microRNA that has been reported to have increased expression in canine and human mammary tumor cell lines [PMC9210832]. It is located at 3p21.1 and is one of the most common genes found in tumor samples [PMC5423597]. MIRLET7G has been identified as one of the top 40 differential genes in a study on pediatric cancers [PMC9730279]. It has also been found to interact with NANOG and POUSF1, suggesting its involvement in adipogenesis and osteogenesis differentiation processes [PMC4951121]. MIRLET7G, along with other microRNAs such as MIR302A, MIR21, and MR137, was selected for validation using qPCR [PMC4951121]. In addition to its role in cancer, MIRLET7G has also been implicated in retinal oxygenation and autophagy regulation [PMC8319207] [PMC6333457]. The reduced expression of MIRLET7G has been associated with the beneficial effects of retinal oxygenation in response to AFL treatment [PMC8319207]. Furthermore, E2 was found to suppress the expression of MIRLET7G in a time- and MAP2K/MEK-MAPK-dependent manner in MCF-7 cells [PMC6333457]. Overall, these findings highlight the importance of MIRLET7G as a potential biomarker and therapeutic target for various diseases.

Genome locations

Gene Ontology annotations

Sequence

Sequence features are shown above as colored rectangles. Zoom in and click to view details, or Reset

Search for similar sequences
AGGCUGAGGUAGUAGUUUGUACAGUUUGAGGGUCUAUGAUACCACCCGGUACAGGAGAUAACUGUACAGGCCACUGCCUUGCCA

Taxonomic tree

View annotations in different species by clicking on species names.

Scroll around to explore the entire tree. Click tree nodes to collapse or expand them. Hover over taxon names to display additional information.

This sequence is found in 19 other species

2D structure Publications