v24

Sorry, there was a problem loading sequence from server. Please try again and contact us if the problem persists.

Homo sapiens (human) long intergenic non-protein coding RNA 28 (LINC00028) URS00003D77DE_9606

Caution, this is an AI generated summary based on literature. This may have errors, see here for more. Please share your feedback with us.

LINC00028: LINC00028, a long intergenic non-protein coding RNA (lncRNA), is upregulated in human tenon's capsule fibroblasts (HTFs) by competitively targeting miR‐204‐5p, thereby regulating the biological function of HTFs [PMC8451868]. In the low-risk group, LINC00028 is significantly amplified [PMC8578893]. It is also implicated in the ceRNA regulatory network of the MAPK pathway, interacting with mRNAs such as RAP1B, ATF2, and PPM1B [PMC7302353]. Knocking down LINC00028 in HTF samples leads to decreased proliferation, migration, and invasion of HTFs [PMC9029189]. In glaucoma and TGF-β induced HTFs, LINC00028 has been found to play a pro-fibrotic role [PMC9029189]. Additionally, LINC00028 has been associated with human papillomavirus (HPV) infection in head and neck squamous cell carcinoma (HNSCC) [PMC8231241]. It is also identified as a survival-related DElncRNA in DElncRNA-mediated ceRNA networks [PMC9372196]. High expression levels of LINC00028 are associated with poor prognosis in various cancers including osteosarcoma and breast cancer [PMC9372196][PMC6414158][PMC8158160][PMC4739325][PMC8896606]. In ceRNA regulatory networks involving RAP1B, ATF2, PPM1B, hsa-miR-124 and hsa-miR-7 are miRNAs that interact with LINC00028 to regulate MAPK signaling pathway-related genes [PMC6414158][PMC8158160].

Genome locations

Gene Ontology annotations

Sequence

Sequence features are shown above as colored rectangles. Zoom in and click to view details, or Reset

Search for similar sequences 
CCCCGCACCCCAGCCUUCCAACGGGGAUGGAUGGCACUCACUCCCACACCCCAACCCCAGCCUGGGGAAGGGAAAAGAAGGAAGGUCUUCCCCCACCCCAAGCUGUCUCCGGCCUGCGGUCAGGGGGAGGGGCUCUAGCUGUGGAAAGUUGGCAGAGGCGGCCGGCAGCAGCCGGGAGAGUGGAAAAAAUGAUAUCAAACCCGGAAAAAUGCAGGCCGGAUGGAGGGCCGGAGUGGGCCCUGGGAGAGGAGACAAAGUUUUGCUGUGUUGCCCAUGAUGGUCUCAAACUCCUGAGCUCAAGAGAUGCUCCCACCUCAACAUCCCAAGGUGCUGAGAUUUCAGGCAUGAGCCACUGGGUCUCACCCUGCUAUCAUAUCUUAAGGCCUUGCAGAAACCAGGAUUUGUUAAAGGAAUGAAAGCUCCUUGAGGGAAGGGCCCUCAGUGCUGCUCUGAUCCCAGCACCUACAACAGUGCCUGGCUCAUAAUAGGUGUCUGUGAAUAAGGAAUGGAAAGCAUGUGAGAAAACCACACUCUUCCUCAGCCUAUUAUAGUUUAAAAAGUACUUUCUCAUCCAUAAAAACAAAACC

Taxonomic tree

View annotations in different species by clicking on species names.

Scroll around to explore the entire tree. Click tree nodes to collapse or expand them. Hover over taxon names to display additional information.

Expression New Publications