v24

Sorry, there was a problem loading sequence from server. Please try again and contact us if the problem persists.

Homo sapiens (human) RARA antisense RNA 1 (RARA-AS1) URS00003D6015_9606

Caution, this is an AI generated summary based on literature. This may have errors, see here for more. Please share your feedback with us.

RARA-AS1: RARA-AS1 is a long noncoding RNA (lncRNA) that has been identified in several studies. Konigsberg et al. used multi-omics data to construct a network in idiopathic pulmonary fibrosis (IPF) and confirmed the dysregulation of RARA-AS1 in the disease [PMC10002924]. Another study identified RARA-AS1 as one of the 13 lncRNAs that exhibited significant differences in children with septic shock [PMC7725549]. Additionally, RARA-AS1 was found to be upregulated in septic shock and was one of the potentially risk lncRNAs associated with the condition [PMC7725549]. In a nasal transcriptome-wide association study (TWAS), RARA-AS1 was one of the genes associated with congenital obstructive airway disease [PMC8960819]. Furthermore, RARA-AS1 was found to be co-expressed with several mRNAs and considered a hub gene in mRNA-lncRNA co-expression networks related to pediatric sepsis [PMC8806204]. Specifically, RARA-AS1 was connected with mRNAs enriched in complement and coagulation cascades, phagosome, leukocyte transendothelial migration, metabolic pathways, and insulin signaling pathways [PMC8806204]. Based on these findings, it is speculated that RARA-AS1 may play a role in the progression of pediatric sepsis by regulating these pathways [PMC8806204].

Targeting miRNAs 3 total

According to LncBase, this RNA is targeted by the following miRNAs:

Genome locations

Gene Ontology annotations

Sequence

Sequence features are shown above as colored rectangles. Zoom in and click to view details, or Reset

Search for similar sequences 
AGAAGUGAAACAAGAGAUGAAGGAAUGUUGCUUGAAAGAAGGAACUCUCAAAGUUCCUCAGCCCUAAUCUAACACAAAUUGCACUUAGGGUUACUGGGGGGAGGGUGCGGCCGGGAGGGUUCAAUUGUCCAGCAAGGGCAACACGGGUUAAGUGAAAGGUAGAGACAGGACCUCCACUACACCCCGGGACUCUCACCCCCGAGUAGUAGUGGAAGCCCUACCGCCCACUCCCACCCCCUACAACAGCAGACUGAGAGGCCGGCAAGAGGUCCGAGCUGGGAAGUCCUGCGCGCCGCCCCCGUCACUCAGCCGGCGGCGCCAUCCGAGCAGAGCAGCUGGGGGAGAGGAGACGUCCCCUCGCCCCGACUGGUGACCCGGGCAGGGGGCGCCCCCUGCCCUGAAGUCCCCGCGUCUAAGUCCGCCGGCCGCUCCGCCAGUCCCGGUGAAAAGCAGGGAAGUUGUGUGUGCUGGGAGGGGGGGUCCGUCGGCUCUCCCAGGGAAGCCUGGCGGGGCCCGGGAACUCAGCGGCUUCACCUCGAGGGGACUCCCGUCUAGAGUCUCGUGGCGUCCGAGGCAGAGUACAGCGGCUCCCCAAGUCCGCAGGCCGGGGGCGGGAUCAGCGCGGGGCUGGGGGUCAACGAGCACUUCCUCCUCCCAGCCGGGGAUCCGGGGCUUCUCCAGGGAUUCUCCGUGGCGAGGAUUCCGGGUGGGGGUGGGGAUCCCGCGCGGUUCCGCCCCCGCCAGGCCAGGGGCAGCUGGCGACUCGCUCGGUCUCUGGUGGUACGCGCCACGGCCCCCCCACCCCAGCUCUGCGCGCCCCCUCCCCUCCGGGCACCACCCCCUUUCCACCGCCCCGCCCCGUCCAGGCACCGCCCCUGGCUUAACCCAUUCCCGGCGCGUCCGGCUGCAGCGGGAGAAACGCAGGGAACCGAGAGGGAGAGGCGGCAUGUGGACAGGCCGGGCCUCAUUUGCCUAAUGCAAUGCGGCUGAACUCUCGCUGAACUCGCCUGGCGGCGCCUCACCUCCGAGUGACCCACCCACCGCUGCCCGUGACAUCACCCGCUCGCCAGCCCGCCCGCGGGGCUCGCCCGCCAGCCCCCUGCCCGGCCGAACCGGGCCACCUCCCCCGGAGACGCGGAGAGCGGCGGCAGGAGGCGUAGGGCCGGGUCGCGCGGGGCCAAGUGUUUGGCACCCGGGUGUGACAUUGUGCAGCUCGGACGCUGUGUCGGAAUGAGACACCGGCUUGUGUCAUUGUCUGUGACAUCAUGUGUGACUCCGGCCGCCGGAACCCGACGCGGCAGCGCGGGUGCUGUUGGCACAAACACAGGCAGAGGGGGCCCUCCUCCCCACGCUCUGCGUGCUUCCGGCGAGCAAAGCCCCGCCCAAGGUGUCUCCUAGCUGGGGAACCAGUACCGGCCCCUGGUGCACUGUCCAGCUCUGGAGAGAUAAAAGGAAGAGCUGGUGCCUUCCAGUGGACUACUUCAUCCUAGAAGCCCUCGGGAUGCACGUUUCACUGGAAGAAAGGCCUAGCUUGGGUAGGUCCCUAGAAAGAGGGGAUACCCCUGGAGGAGGGGGUAUCCUAUUACCCCCACUCUCUAAAAGGAAGGAUGGAAAUGUACAUGCUACCCAAGGACAUUCUUCUAGAAGAAGCCUGGCUCUUUAUAUAUGUUGUCAUUUUAUCCUCACAGCAACUCCAAGAGAUGUUUUACAAAUAAAACAGGUCUCAGCAAGGCUAUGUGGGUUGUCCAAGAUCACAUUACUAAUAAUAAAGAGUAGAGCAGGUAUUUGAA

Taxonomic tree

View annotations in different species by clicking on species names.

Scroll around to explore the entire tree. Click tree nodes to collapse or expand them. Hover over taxon names to display additional information.

Publications