v24

Sorry, there was a problem loading sequence from server. Please try again and contact us if the problem persists.

Homo sapiens (human) MAF transcriptional regulator RNA (MAFTRR) URS00003CD6E9_9606

Caution, this is an AI generated summary based on literature. This may have errors, see here for more. Please share your feedback with us.

MAFTRR: MAFTRR is a gene that has been identified as a potential tumour suppressor, along with other genes such as LEPROTL1, KIAA1551, MIDEAS, and IGF2BP2 [PMC5663922]. The eQTL analyses have shown that MAFTRR does not have a significant effect on the expression of LINC01229, but the serum urate-raising alleles of rs4077450 and rs4077451 do increase the expression of LINC01229 [PMC6348267]. The role of MAFTRR appears to differ between Th1 and CD8+ T cells [PMC8642024]. Therefore, the efficiency of MAFTRR as a biomarker for HT (hypertension) has been assessed [PMC8642024].

Genome locations

Gene Ontology annotations

Sequence

Sequence features are shown above as colored rectangles. Zoom in and click to view details, or Reset

Search for similar sequences 
UUUACCUGCUAGGCUCGUCCCACCUGUGUGGAGCUCCCAUCGCCCUCCAGCGUUGCGCAGCCUGAAGGGACAGGACGGACAAGCGGGUGCCUCCUUCUAAUUCAUCUUCACCAUUGUGGUUGUCAAUAUGGCAUGCAGAAUUAUCCCUCUUUCCAGGUUUUCCCCAAGGACCCUGGACAAUGCUGGUUUUUCCUAUGUGCACCACCAAAGGGCCUAUCCAGCUUCUGGAGUCUACCUGGAUUCCUGGGCUCAUGGCCCCUUCCUCCAUCUUCAAACCAGCAAUGGAAAUGGAAAUGAAAGCAAAAUGGAAGGACGUGAGGUCCUUAUCCUUGGAGAUCCUAUGGAGUCUCCACAGACAUUCCUUGAAGAAAUCAGAUGGAGCUGAGCCUGACACUCUAACCGGUUCUCUGGGUGUACUGCAAAGGUCUAAUAAAAGGCACCUUUGCCCGGUUGCUUCAAUUCUAGGAAGCUGUUCAAUGUUUGACUAUAUUUCUCCAUACUCAUUUGAAAACAGUUCAUCAGGUUAGUUCAGUUGAAUUAUUGCUCCUUGGGAGUUUUCCAAACCCUGGAUUUCCUUCGGAGAGAGCUAGAUUCUAUUCCAUUCUUGGAAUUCAGCUCCUUGCCCUUCUCUGUGACCCCGGAUCGCGAAUGCAGUAAAAAUAAAAAUAUCCUGCUGCCUCCUGCA

Taxonomic tree

View annotations in different species by clicking on species names.

Scroll around to explore the entire tree. Click tree nodes to collapse or expand them. Hover over taxon names to display additional information.

Publications