Sorry, there was a problem loading sequence from server. Please try again and contact us if the problem persists.
Homo sapiens (human) small nucleolar RNA, H/ACA box 54 (SNORA54) secondary structure diagram

Homo sapiens (human) small nucleolar RNA, H/ACA box 54 (SNORA54) URS00003CCCBE_9606

Caution, this is an AI generated summary based on literature. This may have errors, see here for more. Please share your feedback with us.

SNORA54: SNORA54 is a highly expressed singleton that belongs to the class of small nucleolar RNA, H/ACA box (SNORA) [PMC8178906]. It guides the modification of position U4539 in helix H93 of 28S RNA [PMC8178906]. SNORA54 is one of the seven bovine SNORAs that were identified as highly expressed singletons [PMC8178906]. It has also been found to be differentially expressed in individuals with autism spectrum disorder (ASD) [PMC6795181]. In addition, SNORA54 has been observed to be dynamically regulated during differentiation and development, with peak expression seen during different stages [PMC9102014]. SNORA54 has also been found to be differentially expressed in individuals with age-related macular degeneration (AMD) [PMC5813239]. Furthermore, SNORA54 has been associated with suggestive significance in genetic studies and survived multiple testing correction in some cases [PMC8169753] [PMC5534955] [PMC9036230]. It is worth noting that SNORA54 is involved in various biological processes, such as RNA splicing and clotting-related pathways associated with smoking-associated strokes [GeneCards] [GeneCards]

Genome locations

Gene Ontology annotations

Sequence

Sequence features are shown above as colored rectangles. Zoom in and click to view details, or Reset

Search for similar sequences
GAGCACUGUUCGUAACCCGUUAGCCUGGCUGUAGCUAAUGGGUUCCAUUCCGGUGCAAUAGCAUUUCCAGCGACACAUGACUGACUGACUGGUGGCUUUCAGUUUCAGGUCUUGGAGACAAAU

Taxonomic tree

View annotations in different species by clicking on species names.

Scroll around to explore the entire tree. Click tree nodes to collapse or expand them. Hover over taxon names to display additional information.

2D structure Publications