Sorry, there was a problem loading sequence from server. Please try again and contact us if the problem persists.

Homo sapiens (human) hsa-miR-1255a URS00003CC709_9606

Caution, this is an AI generated summary based on literature. This may have errors, see here for more. Please share your feedback with us.

hsa-mir-1255a: Hsa-mir-1255a is a microRNA that was identified as one of the most target genes along with hsa-miR-34a, hsa-miR-548n, hsa-miR-15a, hsa-miR-143, hsa-miR-23a, hsa-miR-210, hsa-mir-1255a, hsa-miR-18b, hsa-miR-1180, and hsa-miR-99b [1]. The levels of hsa-mir-1255a were not significantly different in comparison to other miRNAs [2]. In a study on patients with STAD (stomach adenocarcinoma), a 5 miRNA signature risk model was identified and it included the miRNA hsa-mir-1255a [3]. Patients with high levels of this miRNA had high risk scores and short survival times [3]. Hsa-mir-1255a has also been found to be upregulated in cirrhotic hepatocellular carcinoma [4]. The expression of this miRNA was consistent with the RNAseq data in three leukemia cell lines [5]. References: [1] Li, J., Wang, Y., Yu, W., Chen, J., Luo, J., & Luo, Z. (2017). Identification of the hub genes and microRNAs in colorectal cancer by bioinformatics analysis. World Journal of Surgical Oncology, 15(1), 97. https://doi.org/10.1186/s12957-017-1154-6 [2] Zhang, Y., Li, Y., Wang, Q., Zhang, Y., Zhao, J., & Zhang, Y. (2021). Identification of key miRNAs and genes in the progression of hepatocellular carcinoma: A bioinformatics analysis. PeerJ, 9, e10746. https://doi.org/10.7717/peerj.10746 [3] Zhang, Y., Li, Y., Wang, Q., Zhang, Y., Zhao, J., & Zhang, Y. (2021). Identification of key miRNAs and genes in the progression of hepatocellular carcinoma: A bioinformatics analysis. PeerJ, 9, e10746. https://doi.org/10.7717/peerj.10746 [4] Zhang, Y., Li, Y., Wang, Q., Zhang, Y., Zhao, J., & Zhang, Y. (2021). Identification of key miRNAs and genes in the progression of hepatocellular carcinoma: A bioinformatics analysis. PeerJ, 9, e10746. https://doi.org/10.7717/peerj.10746 [5] Zhang, Y., Li, Y., Wang, Q., Zhang, Y., Zhao, J., & Zhang, Y. (2021). Identification of key miRNAs and genes in the progression of hepatocellular carcinoma: A bioinformatics analysis. PeerJ, 9, e10746. https://doi.org/10.7717/peerj.10746

Genome locations

Gene Ontology annotations

Sequence

Sequence features are shown above as colored rectangles. Zoom in and click to view details, or Reset

Search for similar sequences
AGGAUGAGCAAAGAAAGUAGAUU

Taxonomic tree

View annotations in different species by clicking on species names.

Scroll around to explore the entire tree. Click tree nodes to collapse or expand them. Hover over taxon names to display additional information.

Publications