v24

Sorry, there was a problem loading sequence from server. Please try again and contact us if the problem persists.
Homo sapiens (human) small nucleolar RNA, C/D box 3C secondary structure diagram

Homo sapiens (human) small nucleolar RNA, C/D box 3C URS00003C5431_9606

Caution, this is an AI generated summary based on literature. This may have errors, see here for more. Please share your feedback with us.

SNORD3C: SNORD3C is a C/D box snoRNA that gives rise to 10 to 13 C/D-sdRNAs, which is unusual compared to other snoRNAs [PMC4627319]. It has been found to be aberrantly expressed in different brain regions of patients with alcohol use disorder (AUD) [PMC10008696]. In ovarian cancer tissues, SNORD3C is downregulated compared to normal ovarian tissues [PMC9119353]. It is also downregulated in tumor tissues compared to paired normal tissues in a prognostic model for cancer [PMC9119353]. SNORD3C has the largest weight coefficient in the prognostic model, indicating its potential significance as a prognostic marker [PMC9119353]. Additionally, SNORD3C has been found to be downregulated in patients with Chikungunya virus infection and its dysregulation has been associated with breast cancer progression and age-related immune dysfunction [PMC6599120] [PMC4818440] [PMC9359077]. Furthermore, SNORD3C has been identified as one of the nine snoRNAs that can serve as prognostic and therapeutic targets for ovarian cancer patients [PMC10001105]. It is also differentially expressed in breast cancer and associated with patient outcome, with higher expression being associated with poorer outcome [PMC9803687]. Overall, SNORD3C plays a role in various diseases and may have potential clinical implications.

Targeting miRNAs 16 total

According to LncBase, this RNA is targeted by the following miRNAs:

Genome locations

Gene Ontology annotations

Sequence

Sequence features are shown above as colored rectangles. Zoom in and click to view details, or Reset

Search for similar sequences 
AAGACUAUACUUUCAGGGAUCAUUUCUAUAGUGUGUUACUAGAGAAGUUUCUCUGAACGUGUAGAGCACCGAAAACCACGAGGAAGAGAGGUAGCGUUUUCUCCUGAACGUGAAGCCGGCUUUCUGGCGUUGCUUGGCUGCAACUGCCGUCAGCCAUUGAUGAUCGUUCUUCUCUCCGUAUUGGGGAGUGAGAGGGAGAGAACGCGGUCUGAGUGGUUUUUCCUUCUUGAUGGCUCAAUGACAGAGACUAGCUCGUAAACUCCGGGGCGUUUCUGGGCUGUUCGCUCCUGCUUGGCAUGUCGCGAGAAAGGUUUUCGCCUCCUGUUUCAGCGGUGACGGCUCUUGGGUUUUCUCGGGGUGGCUUUUUAAUUUUAGUCUUGGCGCGAGGCGGGGGAUGCUGUGUGGCACCUCCUAUUGUCUCUUUUUGCGUUUUCUCCCAUUCUCGCUCCCUCUUUUGUCGCCGUUUCCCGCCCGCCACUCCCACCCCCAGACGGGGUCUCCGGGUCUCUUGUUCUGUCUGCCGGCCCCGGCUGGAUUGCAGUGGCGCGAUCUCGGCUCCUAGCAACAUCUGCCUCCCGGGC

Taxonomic tree

View annotations in different species by clicking on species names.

Scroll around to explore the entire tree. Click tree nodes to collapse or expand them. Hover over taxon names to display additional information.

2D structure Publications