v24

Sorry, there was a problem loading sequence from server. Please try again and contact us if the problem persists.

Homo sapiens (human) ANKRD44 intronic transcript 1 (ANKRD44-IT1) URS00003BCF80_9606

Caution, this is an AI generated summary based on literature. This may have errors, see here for more. Please share your feedback with us.

ANKRD44-IT1: ANKRD44-IT1 is a long non-coding RNA (lncRNA) that has been implicated in tumorigenesis, specifically in osteosarcoma (OS) progression [PMC9680297]. Genomic alterations co-occurrence analysis revealed that ANKRD44-IT1 alterations were more commonly observed in the CREB3L1-altered group [PMC9511413]. In OS samples, ANKRD44-IT1 was found to be upregulated compared to normal tissue controls [PMC9680297]. ANKRD44-IT1 was also found to interact with VEGFC and ADCYAP1R1 [PMC9680297]. The localization analysis showed that ANKRD44-IT1 is predominantly located in the cytoplasm of cells [PMC9680297]. In addition, ANKRD44-IT1 has been linked to ulcerative colitis [PMC9194960]. Overall, the findings suggest that ANKRD44-IT1 may play a role in OS progression and may be a potential therapeutic target. However, further research is needed to fully understand the functional significance of ANKRD44-IT1 and its potential role in tumorigenesis.

Targeting miRNAs 2 total

According to LncBase, this RNA is targeted by the following miRNAs:

Genome locations

Gene Ontology annotations

Sequence

Sequence features are shown above as colored rectangles. Zoom in and click to view details, or Reset

Search for similar sequences 
GUUUGGGAAAGAGAAUAUUGGAAUUCAUAUUUCUUUAAAUCAUUCUUUUAAACUUUUAAUUUUUAUGUAGUUUUAGUACAUCUUAUUUGCUAGUACUGUGUCAUCUUUUUGGCUGUAUUUUUCACUGGCUGCCACCUGGCCAAAUCACCACUUGGGUUAUAACAGCAGCCUCUGACUGGUCUCCUUCCGUCUGACCUUGGCCCCUGCACUCUACUCUCAACGUAGCUCUCAGAGUGAUGGAACUCAGAACUUGUCACUCCUGCUCAAAAACUUCCAGUUUCACCCAGGGGAAGUAUCAAGGUGACAUGAGGGGACAGGAAAUAUUGUCCCUAAAUGUUCUAAGAGUGGAUCUCCCAUGUAUUCAAGCAAUCGAGGGGUGUUUAAUGAGCUCCAUCUACAUAGCAAUGAUACAGCAUAGCUCUGCUGGGGCUCUCUGCUCUCCCCUUCUCCACAAAAGGGAAGGACAGGUAAGAACAGGCACAAUAAAAUAGAAACCAGACAGAAAGAAUUGGGAACAAGGAGACAAGACAAGAAUCAUGCUUUACGUGAUUUAAUCCUAAUAUUUUUAUGAGAGGAUGGCUAUCAUCAUUUCAUUUUAAAGAUGAGGAAAAUGAAGCCGGGUGCGGUGGCUCAUGCCUGUAAUCCCAGCACUUUGGAAGGCCGAGGAAGAUGGCUCACCUGAGGUCAGGAGUUCGAGACCAGCCUGGCCAGAGAGAUGGCCAGAGAUGGCUAGAGAUGGUUGCUGCAAAUGCCAUUAUUUCAUUCCUUUUUAUGGCUGAGUAGUAUUCCAUGAGGGAAGGAAUUAGGAGCGGGAAGGAGAUUGACUGUUAGUUUCUUAGGAUUGGACUAACAAAAGUGGAGGUUGUUACUUACACUGCAAAAGAAACAACCAGAGCUGUGUCACUCAGAAGGCUGAAAAGAAUCAGGCUGACAGCAUAAUGCAGUGAAGAUGGGUGAAGAGAGAUGUGUUUCAUCUGAAAUUUGAAGGGCUUUACAACUCUUCUCCUUUAACUAACUUACCAUCCUUUAACUAACUUACCACCCAAAAUGAAUUCUGUAGCCUUUGUCA

Taxonomic tree

View annotations in different species by clicking on species names.

Scroll around to explore the entire tree. Click tree nodes to collapse or expand them. Hover over taxon names to display additional information.

Publications