Sorry, there was a problem loading sequence from server. Please try again and contact us if the problem persists.

Homo sapiens (human) microRNA hsa-mir-19b precursor (hsa-mir-19b-1) URS00003BACA4_9606

Caution, this is an AI generated summary based on literature. This may have errors, see here for more. Please share your feedback with us.

MIR19B1: MIR19B1 is a member of the miR-17~92 cluster and has been associated with various conditions and diseases. It has been linked to the presence of right renal agenesis [PMC9090243]. Additionally, MIR19B1, along with MIR17, MIR18A, and MIR20A, is part of the miR-17–92 cluster on chromosome 13 that is upregulated in lung cancer cell lines and involved in repression of proliferation inhibition and apoptotic agents [PMC6418160]. In the context of malignancy, MIR19B1 has been found to be one of the most upregulated miRNAs [PMC9390975]. In individuals with non-syndromic CAKUT (congenital anomalies of the kidney and urinary tract), pathogenic variants in MIR19B1 have been identified [PMC7998154]. The miR-17~92 cluster genes, including MIR19B1, have been found to be encompassed by a microduplication at 13q31.3 [PMC4005632]. The host gene for the miR-17~92 cluster is MIR17HG, which encodes for six individual miRNAs including MIR19B1 [PMC4005632]. Copy gains or amplifications affecting this locus have also been found to impact the miR17-92 cluster genes [PMC9259584]. References: [PMC9090243] - https://www.ncbi.nlm.nih.gov/pmc/articles/PMC9090243/ [PMC6418160] - https://www.ncbi.nlm.nih.gov/pmc/articles/PMC6418160/ [PMC9390975] - https://www.ncbi.nlm.nih.gov/pmc/articles/PMC9390975/ [PMC7998154] - https://www.ncbi.nlm.nih.gov/pmc/articles/PMC7998154/ [PMC4005632] - https://www.ncbi.nlm.nih.gov/pmc/articles/PMC4005632/ [PMC9259584] - https://www.ncbi.nlm.nih.gov/pmc/articles/PMC9259584/

Genome locations

Gene Ontology annotations

Sequence

Sequence features are shown above as colored rectangles. Zoom in and click to view details, or Reset

Search for similar sequences
CACUGUUCUAUGGUUAGUUUUGCAGGUUUGCAUCCAGCUGUGUGAUAUUCUGCUGUGCAAAUCCAUGCAAAACUGACUGUGGUAGUG

Taxonomic tree

View annotations in different species by clicking on species names.

Scroll around to explore the entire tree. Click tree nodes to collapse or expand them. Hover over taxon names to display additional information.

This sequence is found in 52 other species

  1. Aotus nancymaae (Ma's night monkey) microRNA 19b-1 (ENSANAG00000013287.1)
  2. Ateles geoffroyi microRNA age-mir-19b precursor (age-mir-19b-1)
  3. Bos taurus (cattle) microRNA bta-mir-19b precursor
  4. Camelus dromedarius (Arabian camel) microRNA 19b-1 (ENSCDRG00005012588.1)
  5. Capra hircus (goat) microRNA chi-mir-19b precursor
  6. Carlito syrichta microRNA 19b-1 (ENSTSYG00000022738.2)
  7. Catagonus wagneri (Chacoan peccary) microRNA 19b-1 (ENSCWAG00000004675.1)
  8. Cebus imitator microRNA 19b-1 (ENSCCAG00000013566.1)
  9. Cercocebus atys microRNA 19b-1 (ENSCATG00000021901.1)
  10. Cervus elaphus hippelaphus ncRNA
  11. Chlorocebus sabaeus microRNA 19b-1 (ENSCSAG00000026697.1)
  12. Choloepus hoffmanni miRNA (ENSCHOG00000014732.1)
  13. Colobus angolensis palliatus miRNA (ENSCANG00000008268.1)
  14. Dasypus novemcinctus (nine-banded armadillo) microRNA 19b-1 (ENSDNOG00000027362.1)
  15. Dipodomys ordii (Ord's kangaroo rat) microRNA 19b-1 (ENSDORG00000027454.1)
  16. Erinaceus europaeus miRNA (ENSEEUG00000016139.1)
  17. Gorilla gorilla gorilla ggo-mir-19b-1 (ENSGGOG00000034672.2)
  18. Gorilla gorilla microRNA ggo-mir-19b precursor (ggo-mir-19b-1)
  19. Heterocephalus glaber microRNA 19b-1 (ENSHGLG00000022122.1, ENSHGLG00100022781.1)
  20. Ictidomys tridecemlineatus microRNA 19b-1 (ENSSTOG00000016662.1)
  21. Lagothrix lagotricha microRNA lla-mir-19b precursor (lla-mir-19b-1)
  22. Loxodonta africana (African savanna elephant) microRNA 19b-1 (ENSLAFG00000024970.1)
  23. Macaca mulatta microRNA mml-mir-19b precursor (mml-mir-19b-1)
  24. Macaca nemestrina (pig-tailed macaque) microRNA mne-mir-19b precursor (mne-mir-19b-1)
  25. Mandrillus leucophaeus (Drill) microRNA 19b-1 (ENSMLEG00000014182.1)
  26. Microcebus murinus (gray mouse lemur) microRNA 19b-1 (ENSMICG00000018257.3)
  27. Mustela putorius furo (Domestic ferret) microRNA 19b-1 (ENSMPUG00000022943.1)
  28. Myotis lucifugus (little brown bat) microRNA 19b-1 (ENSMLUG00000029659.1)
  29. Otolemur garnettii microRNA 19b-1 (ENSOGAG00000017419.1)
  30. Ovis aries microRNA oar-mir-19b precursor
  31. Pan paniscus microRNA ppa-mir-19b precursor (ppa-mir-19b-1)
  32. Pan troglodytes (chimpanzee) microRNA ptr-mir-19b precursor (ptr-mir-19b-1)
  33. Pongo abelii (Sumatran orangutan) miRNA
  34. Pongo pygmaeus (Bornean orangutan) microRNA ppy-mir-19b precursor (ppy-mir-19b-1)
  35. Propithecus coquereli (Coquerel's sifaka) microRNA 19b-1 (ENSPCOG00000002195.1)
  36. Pteropus vampyrus microRNA 19b-1 (ENSPVAG00000024416.1)
  37. Rhinopithecus bieti microRNA 19b-1 (ENSRBIG00000005895.1)
  38. Rhinopithecus roxellana microRNA 19b-1 (ENSRROG00000006323.1)
  39. Saguinus labiatus microRNA sla-mir-19b precursor (sla-mir-19b-1)
  40. Saimiri boliviensis boliviensis microRNA 19b-1 (ENSSBOG00000019788.1)
  41. Tursiops truncatus (bottlenosed dolphin) microRNA 19b-1 (ENSTTRG00000023415.1)
Publications