Sorry, there was a problem loading sequence from server. Please try again and contact us if the problem persists.

Homo sapiens (human) hsa-miR-4687-5p URS00003B6938_9606

Caution, this is an AI generated summary based on literature. This may have errors, see here for more. Please share your feedback with us.

hsa-mir-4687: Hsa-mir-4687, along with other miRNAs such as hsa-mir-216b, hsa-mir-363, hsa-mir-940, and hsa-mir-1301, was found to be highly expressed in endometrial cancer (EC) tissues compared to normal tissues [PMC8806668]. However, the expression of hsa-mir-4687 in tumor tissues was contrary to the bioinformatics analysis [PMC8806668]. In addition to hsa-mir-4687, other miRNAs such as hsa-mir-3614 and hsa-mir-3170 were also highly expressed in tumor tissues compared to normal tissues [PMC8806668]. Conversely, five miRNAs including hsa-mir-3614 and hsa-mir-4687 were found to be low-expressed in EC tissues [PMC9318842]. These miRNAs were associated with poor prognosis and lower survival rate in endometrial cancer [PMC9318842]. Hsa-miR-4687 was also identified as playing a role in lung adenocarcinoma and its expression was found to be normal in the circulatory system of cancer patients [PMC9318842]. The super channel of the hsa-miR-4687 gene includes class I MHC-mediated antigen processing and presentation as well as antigen activated B-cell receptor (BCR) pathways that contribute to maintaining homeostasis [PMC9318842]. Finally, a prediction model for EC included 12 miRNA variables including HSA-MIR 138–2, HSA-MIR 548f–1, HSA-MIR 934–1/934–2/934–3/934–4/934–5/934–6/934–7/934–8 (HSA-MIR 934), HSA-MIR 940, HSA-MIR 4758, HSA-MIR 146a, HSA-MIR 3170, HSA-MIR 3614, HSA-MIR 3616, HSA-MIR 4687, HSA-MIR 876 and hsa-mir-1269a [PMC9318842]. The low expression of hsa-mir-4687 was found to be associated with decreased immune response reactivity and the formation of the tumor microenvironment [PMC9318842].

Genome locations

Gene Ontology annotations

Sequence

Sequence features are shown above as colored rectangles. Zoom in and click to view details, or Reset

Search for similar sequences
CAGCCCUCCUCCCGCACCCAAA

Taxonomic tree

View annotations in different species by clicking on species names.

Scroll around to explore the entire tree. Click tree nodes to collapse or expand them. Hover over taxon names to display additional information.

Publications