Sorry, there was a problem loading sequence from server. Please try again and contact us if the problem persists.

Homo sapiens (human) small nucleolar RNA, C/D box 49A (SNORD49A) URS00003B08B2_9606

Caution, this is an AI generated summary based on literature. This may have errors, see here for more. Please share your feedback with us.

SNORD49A: SNORD49A and SNORD49B are both C/D box snoRNAs, which are characterized by the presence of two boxes near their termini (box C and box D) and two boxes away from their termini (boxes D’ and C’)[PMC9622897]. SNORD49A is a specific type of snoRNA that is involved in the regulation of miRNA expression [PMC7578795]. In a study, the relative expression levels of miRNAs were assessed using the comparative Ct (ΔCt) method, where the mean expression level of both SNORD49A and SNORA66 genes was used as a reference for comparison [PMC7578795]. This method allows for a quantitative analysis of miRNA expression levels by normalizing them to reference genes [PMC7578795]. By using SNORD49A as a reference, researchers were able to compare the expression levels of other miRNAs in relation to this specific snoRNA [PMC7578795]. This approach provides valuable insights into the regulation and function of miRNAs in various biological processes [PMC7578795].

mRNA interactions 1 total

Genome locations

Gene Ontology annotations

Sequence

Sequence features are shown above as colored rectangles. Zoom in and click to view details, or Reset

Search for similar sequences
UGCUCUGAUGAAAUCACUAAUAGGAAGUGCCGUCAGAAGCGAUAACUGACGAAGACUACUCCUGUCUGAUU

Taxonomic tree

View annotations in different species by clicking on species names.

Scroll around to explore the entire tree. Click tree nodes to collapse or expand them. Hover over taxon names to display additional information.

This sequence is found in 4 other species

Publications