Sorry, there was a problem loading sequence from server. Please try again and contact us if the problem persists.

Homo sapiens (human) TRIM31 antisense RNA 1 (TRIM31-AS1) URS00003AE208_9606

Caution, this is an AI generated summary based on literature. This may have errors, see here for more. Please share your feedback with us.

TRIM31-AS1: TRIM31-AS1 is a pyroptosis-correlated long non-coding RNA (lncRNA) that has been identified as a protective lncRNA in breast cancer (BC) patients [PMC9393225]. It is one of the six lncRNAs, including OCIAD1-AS1, MAFG-DT, SLC25A25-AS1, SNHG18, PSMB8-AS1, and TRIM31-AS1, that were selected and used to establish a predictive model for BC patients [PMC9393225]. High expression levels of TRIM31-AS1 were associated with better overall survival in BC patients [PMC9393225]. Interestingly, TRIM31-AS1 also displayed higher expression in colon organoids of familial adenomatous polyposis (FAP) patients compared to healthy subjects and in colon tumors compared to normal adjacent tissue (NAT) [PMC9396789]. However, no significant differences in survival were observed for TRIM31-AS1 in the TCGA-COAD cohort [PMC9396789]. TRIM31 antisense RNA 1 (TRIM31-AS1) is one of the genes that mapped within colorectal cancer (CRC) genome-wide association study (GWAS) loci [PMC9396789]. A differentially methylated region adjacent to TRIM31-AS1 and TRIM31 was found to be significantly hypomethylated in FAP and CRC tumors compared to healthy subjects and NAT [PMC9396789]. The specific role of TRIM31-AS1 in CRC has not been determined yet; however, its increased expression may be important for protein regulation through its binding with protein-coding mRNA [PMC9396789]. References: [PMC9393225]

Genome locations

Gene Ontology annotations

Sequence

Sequence features are shown above as colored rectangles. Zoom in and click to view details, or Reset

Search for similar sequences
GGUCUGGGGAAUAAAGAAUGGGAUGAAAUGGUGAGAGUCCAGAGGGGUUGAGCAAAGAACUCACUAUCACACAGCAAGGCACUAAUUUGAAAUGCCUGGGAGAAGUAGAAGCUGCAUUUGACUCUCAUAUUCUUAUUGGACCAGGAAGGCAGGAGGAGACACCAGUGUGCACCAGAGAAGGAGAAGUCAGAGAUGACAGUCCCUGCCUGAGGCCAUCUCUGGUCCACCAGACAACUCAUCACCAACUUCCCAACAGCCACUGCUCUAGGCCAGACUUGGAUCUGCUCUUGAAUCUGCCCCUGCGGAAAGAGGGCCGUUUGGACAGGCUGUGCCUGGAGAUUUCUGGCCUCAUAAAAUCCUCCUGGUCUCUUAGGAGAGCUGGUGACACUCUCCAGGUCCUUGGUGGAGCCUGAUGAUUGACAUCUUAAGCAAAUUCUCUGGAGAAGUCGAUGCUCCUGAUGGAGGCUCACACAUUGAUAACCCCUGGUUUAGAGACACUACUAAUUGUUCCAGCUCAUCCAGCUAAUAAAUGACAGAUCUCAGACUUAA

Taxonomic tree

View annotations in different species by clicking on species names.

Scroll around to explore the entire tree. Click tree nodes to collapse or expand them. Hover over taxon names to display additional information.

Publications