Sorry, there was a problem loading sequence from server. Please try again and contact us if the problem persists.

Homo sapiens (human) hsa-miR-3163 URS00003A5E54_9606

Caution, this is an AI generated summary based on literature. This may have errors, see here for more. Please share your feedback with us.

hsa-mir-3163: Hsa-mir-3163 is a microRNA that has been studied in various contexts, including non-small cell lung cancer, AR positive TNBC, corin regulation, radioresistance, and gene expression analysis [PMC8604295] [PMC9761169] [PMC7050132] [PMC9951953] [PMC7807343]. In non-small cell lung cancer, hsa-mir-3163 has been found to inhibit tumor cell growth [PMC8604295]. In AR positive TNBC, hsa-mir-3163 has been identified as a potential biomarker along with CCNB1 through bioinformatics analysis [PMC8604295]. In the context of corin regulation, hsa-mir-3163 is one of the three candidate miRNAs identified through bioinformatics analysis [PMC9761169]. Hsa-mir-3163 has also been linked with other miRNAs and downstream genes associated with radioresistance in a study on hsa_circ_0004015 [PMC7050132]. Furthermore, in gene expression analysis studies on different genes such as ALB, COL1A2, COL3A1, FN1, G6PC and PCK1; hsa-mir-3163 has been predicted as one of the miRNAs regulating their expression patterns [PMC7807343]. These findings highlight the potential role of hsa-mir-3163 in various biological processes and diseases.

Genome locations

Gene Ontology annotations

Sequence

Sequence features are shown above as colored rectangles. Zoom in and click to view details, or Reset

Search for similar sequences
UAUAAAAUGAGGGCAGUAAGAC

Taxonomic tree

View annotations in different species by clicking on species names.

Scroll around to explore the entire tree. Click tree nodes to collapse or expand them. Hover over taxon names to display additional information.

Publications