Sorry, there was a problem loading sequence from server. Please try again and contact us if the problem persists.

Homo sapiens (human) microRNA hsa-mir-106a precursor URS000039E1E1_9606

Caution, this is an AI generated summary based on literature. This may have errors, see here for more. Please share your feedback with us.

hsa-mir-106a: Hsa-mir-106a is a microRNA that is involved in the regulation of gene expression [PMC7770216]. According to a study by Zhang et al., it was found that HPV E7/DGCR8 inhibits the expression of RUNX3 and enhances radiation sensitivity by promoting the expression of hsa-mir-106a [PMC7770216]. In another study by Liang et al., it was observed that hsa-mir-106a has a reverse pattern of expression compared to its target genes BDH1, UPP1, TUSC2, and KMO in the short-term survival group [PMC3852212]. These target genes were found to be over-expressed in the short-term survival group [PMC3852212].

MIR106A: MIR106A is a microRNA that has been shown to inhibit the target gene MMP2 through transfection [PMC9692470]. The relevance of NFκB and AP-1 transcription factors binding to the miR-106a promoter in response to TNFα signaling was investigated using luciferase assays with a full-length MIR106A construct [PMC6301105]. The study utilized a NFκB inhibitor, Bay 11–7082, and an AP-1 false substrate, c-JUN peptide, in the presence of TNFα [PMC6301105]. The diagnostic performance of MIR106A in colorectal cancer (CRC) was found to be relatively high based on the summary DOR and the area under SROC [PMC5354890]. In a study on aortic aneurysm, circulating miR-17 and miR-20a showed an inverse linear correlation with the maximum aortic diameter, while other microRNAs including MIR106A did not show significance in this regard [PMC7020030]. Additionally, it was found that miR20a and MIR106A negatively regulated WTX expression [PMC6328557]. Overall, these findings highlight the role of MIR106A in gene regulation and its potential diagnostic significance in CRC.

Genome locations

Gene Ontology annotations

Sequence

Sequence features are shown above as colored rectangles. Zoom in and click to view details, or Reset

Search for similar sequences
CCUUGGCCAUGUAAAAGUGCUUACAGUGCAGGUAGCUUUUUGAGAUCUACUGCAAUGUAAGCACUUCUUACAUUACCAUGG

Taxonomic tree

View annotations in different species by clicking on species names.

Scroll around to explore the entire tree. Click tree nodes to collapse or expand them. Hover over taxon names to display additional information.

Publications