Sorry, there was a problem loading sequence from server. Please try again and contact us if the problem persists.

Homo sapiens (human) hsa-miR-539-3p URS000039607D_9606

Caution, this is an AI generated summary based on literature. This may have errors, see here for more. Please share your feedback with us.

hsa-mir-539: Hsa-mir-539 is a microRNA that has been found to be over-expressed in various diseases, including hepatocellular carcinoma (HCC), pancreatic neuroendocrine tumors (PNETs), and colon cancer [PMC3440352] [PMC7894801] [PMC4268797] [PMC7295234] [PMC7352720] [PMC7850735] [PMC8873361] [PMC9941246]. It has been shown to be altered at least four-fold in HCC and highly expressed in PNETs and PDACs, indicating its potential role as a biomarker for these diseases [PMC3440352] [PMC7352720]. Additionally, hsa-mir-539 has been found to be associated with prognosis in HCC patients, with its expression levels correlating with patient outcomes across different datasets [PMC7467934]. Furthermore, hsa-mir-539 is part of a miRNA signature that includes other miRNAs such as hsa-miR-549, hsa-miR-518b, and hsa-miR-152, which have also been associated with prognosis in HCC patients across different datasets [PMC7467934]. These findings highlight the potential of hsa-mir-539 and other miRNAs as prognostic markers for HCC.

Genome locations

Gene Ontology annotations

Sequence

Sequence features are shown above as colored rectangles. Zoom in and click to view details, or Reset

Search for similar sequences
AUCAUACAAGGACAAUUUCUUU

Taxonomic tree

View annotations in different species by clicking on species names.

Scroll around to explore the entire tree. Click tree nodes to collapse or expand them. Hover over taxon names to display additional information.

This sequence is found in 3 other species

  1. Gorilla gorilla gorilla ggo-miR-539 (MIR539)
  2. Gorilla gorilla (western gorilla) ggo-miR-539
  3. Tupaia chinensis (Chinese tree shrew) tch-miR-539-3p
Publications