Sorry, there was a problem loading sequence from server. Please try again and contact us if the problem persists.
Homo sapiens (human) microRNA hsa-mir-181c precursor secondary structure diagram

Homo sapiens (human) microRNA hsa-mir-181c precursor URS0000394A9E_9606

Caution, this is an AI generated summary based on literature. This may have errors, see here for more. Please share your feedback with us.

MIR181C: MIR181C is a microRNA that translocates to mitochondria and affects the expression of mitochondrial transcripts in CMCs [PMC7123062]. It has been found to target phosphatidylethanolamine binding protein 1 (PEPB1) and is downregulated in the TvN in both the membrane and cytoplasmic fraction [PMC10057657]. When MIR181C is hypermethylated, it leads to increased expression of NOTCH2/4 and KRAS, which affects proliferation levels [PMC7215608]. The transcription factor binding analysis suggests that rs8108402 may be the binding site for Sp1 transcription factors, indicating its role in the transcriptional regulation of MIR181C [PMC9396029]. Elevated levels of MIR181C may contribute to the reduction of CXCL8 [PMC5422244]. Quercetin treatment has been shown to suppress MIR181C expression in neutrophils [PMC5422244]. Dex treatment decreases MIR181C expression in T24 cells but not UMUC-3 cells [PMC5053652]. Hypermethylation of MIR181C has been observed in AD brains, leading to downregulation of its corresponding transcript [PMC4861808]. MIR181C is among several miRNAs predicted to target H-2Kb and H-2Db [PMC7655649]. It has also been identified as a potential marker for a positive response to chemoradiotherapy with TMZ in glioblastoma patients [PMC7073212]. Additionally, miRNA mimics have been used for overexpression studies of miR181a and MIR181C with different time points posttransfection or postirradiation observed [PMC8786676].

Genome locations

Gene Ontology annotations

Sequence

Sequence features are shown above as colored rectangles. Zoom in and click to view details, or Reset

Search for similar sequences
CGGAAAAUUUGCCAAGGGUUUGGGGGAACAUUCAACCUGUCGGUGAGUUUGGGCAGCUCAGGCAAACCAUCGACCGUUGAGUGGACCCUGAGGCCUGGAAUUGCCAUCCU

Taxonomic tree

View annotations in different species by clicking on species names.

Scroll around to explore the entire tree. Click tree nodes to collapse or expand them. Hover over taxon names to display additional information.

2D structure Publications