Sorry, there was a problem loading sequence from server. Please try again and contact us if the problem persists.

Homo sapiens (human) cancer susceptibility 11 (CASC11) URS0000392533_9606

Caution, this is an AI generated summary based on literature. This may have errors, see here for more. Please share your feedback with us.

CASC11: CASC11 is a long non-coding RNA (lncRNA) that is significantly overexpressed in various tumors [PMC8843879]. It has been found to increase UBE2T expression by enhancing the stability of UBE2T mRNA [PMC8652064]. Additionally, CASC11 upregulates E2F1 expression through the recruitment of EIF4A3, activating the NF-κB and PI3K/AKT/mTOR pathways to promote hepatocellular carcinoma (HCC) progression [PMC9716033]. CASC11 may also be involved in colorectal cancer (CRC) pathogenesis as a WNT signal regulator [PMC8843879]. In patients with bladder cancer, the expression of CASC11 is inversely and significantly correlated with miRNA-150 [PMC6619255]. In prostate cancer (PCa), CASC11 interacts with the YBX1/p53 axis and regulates PCa progression [PMC9374466]. It has been reported that CASC11 can promote the expression of MMP7, which mediates the release of TNF-α, suggesting a potential interaction between CASC11 and TNF-α [PMC6759792]. High levels of CASC11 are associated with poor prognosis in patients with coronary artery disease (CAD) [PMC7133399]. In gastric cancer (GC), LINC01116 interacts with CASC11 to regulate invasion and migration of GC cells [PMC8553226]. Furthermore, in liver cancer and CRC, CASC11 activates the PI3K/AKT pathway to promote progression and metastasis [PMC8084185]. Overexpression of CASC11 also facilitates tumor growth and metastasis in vivo [PMC8652064]. In HCC tissues, high expression levels of CASC11 are significantly correlated with low 5-year overall survival rate, suggesting its potential as a therapeutic target for HCC treatment [PMC6488862]. Finally, CASC11 exerts its functional role through MYC in HCC [PMC9490101].

Genome locations

Gene Ontology annotations

Sequence

Sequence features are shown above as colored rectangles. Zoom in and click to view details, or Reset

Search for similar sequences
UCUUUCAGGUUGGCUGCAGAAGGUCCGAAGAAAGAGGAGUUACUGGAGGAAAAAGUGGUUCAGAGGUGACUAUUCAACCGCAUAAGAGAUGGUGAAAAUUAACCUAUCACCACUGCUAAUGAACAUCACCCUAUGGAGAACCGAGACACAAAAGGGAAGAUUCAGAAUGUGUGACUUGUAUAAAAUAAAACCAGUUUCCCCCGACCCCAACACCUUCUUUGAACAUCUCUUUCUCCACCUCUCAAAAAAUUUCCUACUGAGUUGGUCCUCUAGUGAAAAGAGCAGUUAAUAAGAUGGAAAGCAACUGGACGUGGUGAAGAAAAAGCCAGCGAACUUAGGGGUGAGACUGAAGCCCCUCAGGGUGGCUGAGCUGCUAUUUGAAAAAUUCCUUCAAGUCACGUGCGGCCUGUCAAGAGAUGAGGUGAAGGAAGAGAAUGAUAAAUAUCUAUCUCCAGUGGAAGGAUCAUUUUGAAAGAAGGGCUGUUAGAUUAAAAACCAAGCUAGCCAGGGAACGUUAAAGGAAGAGAAGUUCUCACAAGCAUUUUAAUGCCAAGCAUGUGUUCCAACGAGAGGAACACAGGAAAGCUCUUCAGCAGAUGAGAAAAUGAAAUUCGGCAUCACUAAUUCAUAGGAAUGAUAACAAAAACGGCAGUGAAGAAAAUCUGUGCAUUUUAAAAAAUGCAUGUUUUUUGCUUAGUGUUGUCCCUUCCCCUCCUGGCUUUUAGUAUACUGCAUUCAUUAAAGUAGCUGAGAAGAAAAAUAGUAGAUGCUGUUAACGUCAGGCCUGAGAGCUUCCAUAUCCUGUGUUGCGUUGAGUUUUGGGUUUGUUUCCUUAUUCACUGUCUUCUAGAUCUCAGACCCUAGCAGAAGGU

Taxonomic tree

View annotations in different species by clicking on species names.

Scroll around to explore the entire tree. Click tree nodes to collapse or expand them. Hover over taxon names to display additional information.

Publications