Sorry, there was a problem loading sequence from server. Please try again and contact us if the problem persists.

Homo sapiens (human) hsa-miR-526b-3p URS000038B25B_9606

Caution, this is an AI generated summary based on literature. This may have errors, see here for more. Please share your feedback with us.

hsa-mir-526b: Hsa-mir-526b is an up-regulated miRNA that is part of the hub genes/miRNAs network [PMC7851075]. The down-regulated miRNAs in this network include hsa-miR-452*, hsa-miR-502, hsa-miR-377, hsa-miR-423, hsa-miR-136, hsa-miR-328, and hsa-miR-504 [PMC7851075]. The target genes of these down-regulated miRNAs are SFTPB, SFTPC, NKX2-1, FBLN1, COL11A1, DCN, and COL1A1 [PMC7851075]. On the other hand, the up-regulated miRNAs in this network include hsa-miR-518c, hsa-miR-584, hsa-miR-134, hsa-miR-623, hsa-miR-765, hsa-miR-663a, hsa-mir-526b, hsa-miR-622, and hsa-miR-605 [PMC7851075]. The target genes of these up-regulated miRNAs are COL1A1, DCN, SCGB1A1, NKX2-1, SFTPB, and FBLN1 [PMC7851075].

Genome locations

Gene Ontology annotations

Sequence

Sequence features are shown above as colored rectangles. Zoom in and click to view details, or Reset

Search for similar sequences
GAAAGUGCUUCCUUUUAGAGGC

Taxonomic tree

View annotations in different species by clicking on species names.

Scroll around to explore the entire tree. Click tree nodes to collapse or expand them. Hover over taxon names to display additional information.

Publications