Sorry, there was a problem loading sequence from server. Please try again and contact us if the problem persists.
Homo sapiens (human) small nucleolar RNA, H/ACA box 7A (SNORA7A) secondary structure diagram

Homo sapiens (human) small nucleolar RNA, H/ACA box 7A (SNORA7A) URS00003852FE_9606

Caution, this is an AI generated summary based on literature. This may have errors, see here for more. Please share your feedback with us.

SNORA7A: SNORA7A is an H/ACA box snoRNA that has been identified as a crucial regulator in human umbilical cord mesenchymal stem cell proliferation and self-renewal, which has implications for stem cell therapy [PMC7522514]. It has been found that SNORA7A expression is negatively correlated with cyclin-dependent kinase inhibitor (CDKN1B), adenylyl cyclase (ADCY9), and downstream effector of Rho (ROCK1) [PMC7844330]. SNORA7A, along with SNORA65 and SNORA7B, is highly expressed in tumor samples compared to normal non-tumor matched controls [PMC7862062]. In terms of its function, SNORA7A inhibits osteogenesis by inhibiting H19-induced osteogenic gene expression [PMC7844330]. Other snoRNAs, such as SNORD89 and SNORD42A, have been identified as biomarkers for ovarian cancer and leukemia, respectively [PMC9115109]. Additionally, snoRNAs like SNORA50 and SNORA71A have been shown to act as oncogenes or tumor-suppressive genes in prostate cancer and colorectal cancer [PMC9115109]. In non-small cell lung cancer (NSCLC), snoRNAs like SNORA42 have been found to be activated and regulate cancer development through both p53-dependent and p53-independent pathways [PMC9115109]. Furthermore, increased expression of the H/ACA box protein NOP10 is associated with a poor prognosis in NSCLC patients and its deletion inhibits lung cancer cell growth by dysregulating the expression of snoRNAs such as SNORA65, SNORA7A, and SNORA7B [PMC7862062].

Genome locations

Gene Ontology annotations

Sequence

Sequence features are shown above as colored rectangles. Zoom in and click to view details, or Reset

Search for similar sequences
GACCUCCUGGGAUCGCAUCUGGAGAGUGCCUAGUAUUCUGCCAGCUUCGGAAAGGGAGGGAAAGCAAGCCUGGCAGAGGCACCCAUUCCAUUCCCAGCUUGCUCCGUAGCUGGCGAUUGGAAGACACUCUGCGACAGUG

Taxonomic tree

View annotations in different species by clicking on species names.

Scroll around to explore the entire tree. Click tree nodes to collapse or expand them. Hover over taxon names to display additional information.

2D structure Publications