Sorry, there was a problem loading sequence from server. Please try again and contact us if the problem persists.
Homo sapiens (human) small NF90 (ILF3) associated RNA A1 (SNAR-A1, SNAR-A2) secondary structure diagram

Homo sapiens (human) small NF90 (ILF3) associated RNA A1 (SNAR-A1, SNAR-A2) URS00003848F7_9606

Caution, this is an AI generated summary based on literature. This may have errors, see here for more. Please share your feedback with us.

SNAR-A1: SNAR-A1 is a small NF90-associated RNA A gene that is encoded in multiple sites in the genome [PMC6021339]. It was identified through the Custom TaqMan Small RNA Assay and is part of a group of 14 copies of the SNAR-A genes [PMC9151912]. In a study on tumor recurrence in stage II/III colorectal cancer patients, SNAR-A1 was found to have low expression levels in the recurrence group compared to the non-recurrence group [PMC6607086]. This study also identified nine other genes (ADH1A, ADH1C, CA12, CHP2, HMGCS2, TPI1, MS4A12, PLA2G10, and PTPRO) that were associated with tumor recurrence [PMC6607086]. These genes were not previously documented in microarray-based gene expression profiling studies for predicting tumor recurrence in colorectal cancer patients not receiving Ox-based adjuvant chemotherapy [PMC6607086]. A heat map analysis showed that the expression levels of these 10 genes allowed for classification of specimens into recurrence and non-recurrence groups [PMC6607086]. Additionally, two common genes with stimulated expression were CYP24A1 and SNAR-A1 [PMC6213311].

Genome locations

Gene Ontology annotations

Sequence

Sequence features are shown above as colored rectangles. Zoom in and click to view details, or Reset

Search for similar sequences
CCGGAGCCAUUGUGGCUCAGGCCGGUUGCGCCUGCCCUCGGGCCCUCACGGAGGCGGGGGUUCCAGGGCACGAGUUCGAGGCCAGCCUGGUCCACAUGGGUCGGAAAAAAGGACUUUUUUUU

Taxonomic tree

View annotations in different species by clicking on species names.

Scroll around to explore the entire tree. Click tree nodes to collapse or expand them. Hover over taxon names to display additional information.

2D structure Publications