Homo sapiens (human) ARAP1 antisense RNA 1 (ARAP1-AS1)

Sorry, there was a problem loading sequence from server. Please try again and contact us if the problem persists.

Homo sapiens (human) ARAP1 antisense RNA 1 (ARAP1-AS1) URS0000379690_9606

388 nucleotides
8 databases (ENA, Ensembl, Ensembl/GENCODE, EVlncRNAs, GeneCards, HGNC, LncBook, NONCODE)
Found in 0 other species
35 publications
1. lncRNA
2. antisense lncRNA

Caution, this is an AI generated summary based on literature. This may have errors, see here for more. Please share your feedback with us.

ARAP1-AS1: ARAP1-AS1 is a long non-coding RNA (lncRNA) that has been shown to regulate clear cell renal cell carcinoma (ccRCC) progression by inhibiting miR-361-3p to enhance PGF expression [PMC8806691]. However, the expression level, biological function, and molecular function of ARAP1-AS1 in lung cancer tissues remain unclear [PMC7797826].

Genome locations

Gene Ontology annotations

Sequence

Sequence features are shown above as colored rectangles. Zoom in and click to view details, or Reset

Search for similar sequences

AAAAUAUACAGAUAUAUUUAUAUUAUCAAAAAGUCCCCAAAUUGGGGAAGGGGCAUCAGGUAGUCUGGACCCCCCACUCAGCCCAGACUGGAAGGAAGGCUGAAGUCCCCAAAGCGCAGCUCUCAGCCCUGUAGAAGCUCAGCCAAGAGCUCCCUCCCCGUGAGCUGAGUGCUCCUCUACAGCACCCGCUUUCUGCUGUUCUGGAGUUUGUUGGGAGGAGCAGGGGGCUCCCUUCCGGCAGGGCCCCAGGGCCUCACGCCUCUGAAAGGGUGGUGGUCCUCCCAAGUUCCUGACUUAUGCCCAUCUCUCCAGCCCCACAAGGACAGUGAACCCGGUGGGGUGAGCAGGAUGGGCAGCACCUUCUCCGCAAAGUGCAGGGGGCGCUCUG

Taxonomic tree

View annotations in different species by clicking on species names.

Scroll around to explore the entire tree. Click tree nodes to collapse or expand them. Hover over taxon names to display additional information.

Publications