Sorry, there was a problem loading sequence from server. Please try again and contact us if the problem persists.

Homo sapiens (human) hsa-miR-449b-5p URS00003758F0_9606

Caution, this is an AI generated summary based on literature. This may have errors, see here for more. Please share your feedback with us.

hsa-mir-449b: Hsa-mir-449b is a microRNA that has been found to be differentially expressed between stage I and stage III cases [PMC9264529]. It is structurally similar to hsa-miR-34b*, hsa-miR-34b, hsa-miR-34c-5p, and hsa-miR-449a, which are downregulated in the testes of infertile men [PMC5399401]. The expression of hsa-mir-449b was detected using Taqman Universal MMIX II and Taqman probes [PMC6663943]. It has been shown that hsa-mir-449b can reduce the luciferase activity of certain reporter vectors when transfected with specific miRNA mimics [PMC6396440]. Hsa-mir-449b is one of the miRNAs that were analyzed in a study investigating miRNA expression profiles following carbon ion radiation exposure in mouse testis [PMC6024298]. Hsa-mir-449b is also associated with breast cancer, as it has predicted target genes that are breast cancer-associated genes [PMC5357838]. In male infertility, the expression of hsa-mir-449b has been found to be significantly downregulated in oligoasthenoterathospermia cases compared to other infertility groups and control group [PMC7851476]. The expression of hsa-mir-449b is negatively correlated with sperm progressive motility, sperm count, and normal morphology [PMC7851476]. Hsa-mir-449b is also part of gene modules constructed using the MCODE algorithm in a study investigating gene networks associated with cancer progression [PMC7339803]. Additionally, a variant in hsa-mir-449b has been identified at position 27 of the 5' arm and affects its secondary structure [PMC6863982].

mRNA interactions 1 total

Genome locations

Gene Ontology annotations

Sequence

Sequence features are shown above as colored rectangles. Zoom in and click to view details, or Reset

Search for similar sequences
AGGCAGUGUAUUGUUAGCUGGC

Taxonomic tree

View annotations in different species by clicking on species names.

Scroll around to explore the entire tree. Click tree nodes to collapse or expand them. Hover over taxon names to display additional information.

This sequence is found in 5 other species

  1. Bos taurus bta-miR-449b
  2. Capra hircus (goat) chi-miR-449b-5p
  3. Macaca mulatta (Rhesus monkey) mml-miR-449b-5p
  4. Pan troglodytes ptr-miR-449b
  5. Pongo pygmaeus ppy-miR-449b
Publications