Sorry, there was a problem loading sequence from server. Please try again and contact us if the problem persists.

Homo sapiens (human) hsa-miR-4721 URS000036D67C_9606

Caution, this is an AI generated summary based on literature. This may have errors, see here for more. Please share your feedback with us.

hsa-mir-4721: Hsa-mir-4721 is a microRNA precursor that has been studied in various contexts [PMC7566007]. Lentiviral particles carrying the hsa-mir-4721 precursor were used to generate two stably transfected cell lines, HONE1-miR-4721 and SUNE1-miR-4721 [PMC7566007]. Hsa-mir-4721 is one of the miRNAs predicted to interact with the 3' UTR of PCSK9, along with several other miRNAs [PMC5874276]. It has been found to promote the invasion capacity of nasopharyngeal carcinoma cells [PMC10050890]. Hsa-mir-4721 is also upregulated in the skin of patients with postherpetic neuralgia (PHN) compared to controls [PMC8914318]. In the context of hepatic fibrosis, hsa-mir-4721 has been found to have lower accuracy compared to other miRNAs such as miRNA-3162 and miRNA-1225 in indicating hepatic fibrosis [PMC7939739]. It is also differentially expressed between different liver fibrosis stages and can be used as a diagnostic marker for significant liver fibrosis [PMC7939739]. Additionally, hsa-mir-4721 has been identified as one of the miRNAs targeting candidate genes associated with child obesity traits [PMC9092671].

Genome locations

Gene Ontology annotations

Sequence

Sequence features are shown above as colored rectangles. Zoom in and click to view details, or Reset

Search for similar sequences
UGAGGGCUCCAGGUGACGGUGG

Taxonomic tree

View annotations in different species by clicking on species names.

Scroll around to explore the entire tree. Click tree nodes to collapse or expand them. Hover over taxon names to display additional information.

Publications