v24

Sorry, there was a problem loading sequence from server. Please try again and contact us if the problem persists.

Homo sapiens (human) GALNT8 antisense upstream 1 (GAU1) URS0000362066_9606

Caution, this is an AI generated summary based on literature. This may have errors, see here for more. Please share your feedback with us.

GAU1: GAU1 is a long non-coding RNA (lncRNA) that has been identified as a novel oncoRNA involved in promoting retinoblastoma (RB) tumorigenesis [PMC7198571]. In a previous study, it was reported for the first time that GAU1 plays a role in promoting RB tumorigenesis [PMC7198571]. To further investigate the function of GAU1, SW620 and DLD1 cells were manipulated to either overexpress or control GAU1 expression and were then seeded in a 96-well plate at a density of 1 × 103 cells per well [PMC8233076]. These cells were incubated with low serum medium (1% v/v FBS) with or without oxaliplatin, an anticancer drug [PMC8233076]. The purpose of this experiment was to study the effects of manipulated GAU1 expression and oxaliplatin on these cells [PMC8233076].

Genome locations

Gene Ontology annotations

Sequence

Sequence features are shown above as colored rectangles. Zoom in and click to view details, or Reset

Search for similar sequences 
UGCCUUUUAAACGCUUGUUCUGUCUCUUUCUAACUCCUUUGUCUCCGCCGGACUCGGGGUAUCCGCUGGGUGGUGUGGGGCUGGUUUCCCCAACAGCUUUCUCUCCACCCAGCUUCAUAGAUGACACCCUGCCUGCUAGGCCAGAUGUUCUCCGGCCAAGAACACUAUUAUAGCUGCCUGGCUUCUCCCUGAGCAGCGUCAGGUGUGAGGAGUGCGCAUGGCAGCUGCCCAGUGACAGAUGGAAUCUCCCUCUCUCACCCAGGCUGGAGUGCAAUGGCACAAUCAGCUCACUGCAACCUCCACCUCCCGGGUUCAAGUGAUUCUUCUGCCUCAGCCUCCCGAGUAGCUGGGACUACAGCCUUCAUUUCAGUCAACAACCACAUAACAGAUCAUCAAAAUACAUAAAGCAAAAACUGACAGAACUAAAGUUAAAUAUACAUAUCUACAAUUAUGUAGAGAAUAACAAACAAAAAAAUAGAACAAAAAUGUUCCACGCCUUGGUCAAUGGUACCACCAGCCAGCGAGGUUCCCAAGCCAAGAACUUCGGAAGCAUCCGUGAUUCUUCAUCUUCCACAUCCACUUUAUCACCGGAAGCACGCAUUCAACUUUCUAAACAUCCCUCAGACUGACCCACAUCUUUCUAUCCACUUUUCACAUCUUGCUUGAAUGACUUCCCCAGGCCCAGCCAGUCUCCCGCCUCCAGCUCCGCCCCCUUCUGACUCCCUUUAUGUGGUACAAUCAGAGAGCCCUUCCCAAAGCACAAAUCUGCUUUCACUGCUUUGCUUCAAGCCCUUUCGUGGCUCCUAUUUCCAGCUGGAUGAGGUCCAAGCCUCUUAACGUGCUGUACGUGUACAUGCCUGACCCCCGCUACUUGACCAGCCAAGUUUCUUCAUAGCGCUGUGUCUUUGUUCCUCCUGCCUAGAAUGUCCUUCCCCUUUUCUCUCGCUUCAUGGUGUGCCAAACUCCUAUCCUGUGAGAUCCAGCUUACACGUCAGCUUCCCCGUGAUGCUUUUCCUAACUCCCUAUUCAGCCAGUGAAGUGCUCCCUGCGUUCCCAUGUGGCUUGUAUCUCUGUAAAAGCUCCACAGAGCUGUUUUAAUUUAUCCGUUAAUGUACAUGUCUUCCCCACUAGACUUUUGCUCCUUAAAGUAUCUCCUUCAUCUCUGCUUUGCAUAACCUAACAGAGUUCAACACAUAGGAGUGUCUUAAUAAAUGCUGAAUAAAAUAAUUAAUAAACAAAUGAAACAAUA

Taxonomic tree

View annotations in different species by clicking on species names.

Scroll around to explore the entire tree. Click tree nodes to collapse or expand them. Hover over taxon names to display additional information.

Expression New Publications