Sorry, there was a problem loading sequence from server. Please try again and contact us if the problem persists.

Homo sapiens (human) hsa-miR-18a-5p URS000035CC3E_9606

Caution, this is an AI generated summary based on literature. This may have errors, see here for more. Please share your feedback with us.

hsa-mir-18a: Hsa-mir-18a is a member of the oncogenic miR-17/92 miRNA cluster, which is frequently overexpressed and has a prognostic role in lung cancer [PMC6405743]. In primary human dermal microvascular endothelial cells (HDMEC) treated with radiation, hsa-mir-18a was found to be downregulated, along with hsa-miR-125a, hsa-miR-127, hsa-miR-148b, hsa-miR-189, and hsa-miR-503 [PMC3424689]. To investigate the role of hsa-mir-18a further, digoxigenin (Dig)-conjugated probes specific to this miRNA were used in an experiment [PMC4007194]. The study found that 324 genes were identified as targets of hsa-mir-18a [PMC8797695]. Additionally, other miRNAs such as hsa-let-7g, hsa-miR-16, hsa-miR-20a, and hsa-miR21 were upregulated in HDMEC after radiation treatment [PMC3424689]. The overexpression of the oncogenic miRNA cluster has been associated with lung cancer prognosis [PMC6405743], while the downregulation of specific miRNAs including has mir 18a may have implications in radiation response. The study also identified other genes targeted by different miRNAs such as has mir 3170 and has mir 4762 [PMC8797695]. These findings contribute to our understanding of the role of specific miRNAs like has mir 18a in cancer development and response to treatment.

mRNA interactions 6 total

Genome locations

Gene Ontology annotations

Localisation

Sequence

Sequence features are shown above as colored rectangles. Zoom in and click to view details, or Reset

Search for similar sequences
UAAGGUGCAUCUAGUGCAGAUAG

Taxonomic tree

View annotations in different species by clicking on species names.

Scroll around to explore the entire tree. Click tree nodes to collapse or expand them. Hover over taxon names to display additional information.

This sequence is found in 43 other species

  1. Alligator mississippiensis (American alligator) ami-miR-18-5p
  2. Anolis carolinensis (green anole) aca-miR-18a-5p
  3. Bos taurus Bta-Mir-17-P2a_5p (mature (guide))
  4. Callorhinchus milii (elephant shark) Cmi-Mir-17-P2a_5p (mature (guide))
  5. Canis lupus familiaris Cfa-Mir-17-P2a_5p (mature (guide))
  6. Capra hircus chi-miR-18a-5p
  7. Cavia porcellus (domestic guinea pig) cpo-miR-18a-5p
  8. Chrysemys picta bellii (western painted turtle) Cpi-Mir-17-P2a_5p (mature (guide))
  9. Columba livia Cli-Mir-17-P2a_5p (mature (guide))
  10. Cricetulus griseus cgr-miR-18a-5p
  11. Cyprinus carpio ccr-miR-18a
  12. Danio rerio (zebrafish) Dre-Mir-17-P2a1_5p (mature (guide))
  13. Dasypus novemcinctus (nine-banded armadillo) dno-miR-18a-5p
  14. Echinops telfairi Ete-Mir-17-P2a_5p (mature (guide))
  15. Eptatretus burgeri Ebu-Mir-17-P2e_5p (mature (guide))
  16. Equus caballus (horse) eca-miR-18a
  17. Gadus morhua Gmo-Mir-17-P2a1_5p (mature (guide))
  18. Gallus gallus (chicken) Gga-Mir-17-P2a_5p (mature (guide))
  19. Gekko japonicus Gja-Mir-17-P2a_5p (mature (guide))
  20. Latimeria chalumnae Lch-Mir-17-P2a_5p (mature (guide))
  21. Lepisosteus oculatus Loc-Mir-17-P2a_5p (mature (guide))
  22. Macaca mulatta (Rhesus monkey) Mml-Mir-17-P2a_5p (mature (guide))
  23. Microcaecilia unicolor Mun-Mir-17-P2a_5p (mature (guide))
  24. Microcebus murinus mmr-miR-18
  25. Monodelphis domestica (gray short-tailed opossum) Mdo-Mir-17-P2a_5p (mature (guide))
  26. Monopterus albus (swamp eel) Mal-Mir-17-P2a2b_5p (mature (guide))
  27. Mus musculus (house mouse) mmu-miR-18a-5p
  28. Ophiophagus hannah (king cobra) oha-miR-18a-5p
  29. Oreochromis niloticus (Nile tilapia) oni-miR-18a-2
  30. Ornithorhynchus anatinus Oan-Mir-17-P2a_5p (mature (guide))
  31. Oryctolagus cuniculus (rabbit) ocu-miR-18a-5p
  32. Oryzias latipes (Japanese medaka) ola-miR-18
  33. Otolemur garnettii oga-miR-18
  34. Petromyzon marinus pma-miR-18a-5p
  35. Python bivittatus (Burmese python) pbv-miR-18a-5p
  36. Rattus norvegicus rno-miR-18a-5p
  37. Sarcophilus harrisii (Tasmanian devil) Sha-Mir-17-P2a_5p (mature (guide))
  38. Scyliorhinus torazame Sto-Mir-17-P2a_5p (mature (guide))
  39. Sphenodon punctatus (tuatara) Spt-Mir-17-P2a_5p (mature (guide))
  40. Taeniopygia guttata Tgu-Mir-17-P2a_5p (mature (guide))
  41. Tetraodon nigroviridis Tni-Mir-17-P2a1_5p (mature (guide))
  42. Xenopus laevis Xla-Mir-17-P2a3_5p (mature (guide))
  43. Xenopus tropicalis xtr-miR-18a-5p
Publications