Sorry, there was a problem loading sequence from server. Please try again and contact us if the problem persists.
Homo sapiens (human) RNA, U6 small nuclear 1 (RNU6-1) secondary structure diagram

Homo sapiens (human) RNA, U6 small nuclear 1 (RNU6-1) URS000035C796_9606

Caution, this is an AI generated summary based on literature. This may have errors, see here for more. Please share your feedback with us.

RNU6-1: RNU6-1, also known as U6, is commonly used as a normalization tool between samples [PMC3262198]. In breast cancer patients without active disease, levels of U6/RNU6-1 and the U6/SNORD44 ratio were found to be elevated in the sera [PMC3262198]. This suggests that U6/RNU6-1 may not be a suitable normalization tool in these cases [PMC3262198]. In early-stage colon carcinoma, circulating extracellular vesicle (EV)-associated miR-125a-3p has been proposed as a diagnostic biomarker for early detection and monitoring of the disease [PMC6429352]. This specific miRNA may serve as a potential biomarker for colon cancer due to its association with EVs [PMC6429352]. These findings highlight the potential of using circulating miRNAs and EVs as diagnostic tools for specific types of cancer, such as breast cancer and colon carcinoma [PMC3262198][PMC6429352].

mRNA interactions 2 total

Genome locations

Gene Ontology annotations

Sequence

Sequence features are shown above as colored rectangles. Zoom in and click to view details, or Reset

Search for similar sequences
GUGCUCGCUUCGGCAGCACAUAUACUAAAAUUGGAACGAUACAGAGAAGAUUAGCAUGGCCCCUGCGCAAGGAUGACACGCAAAUUCGUGAAGCGUUCCAUAUUUU

Taxonomic tree

View annotations in different species by clicking on species names.

Scroll around to explore the entire tree. Click tree nodes to collapse or expand them. Hover over taxon names to display additional information.

This sequence is found in 3 other species

  1. Cervus elaphus hippelaphus ncRNA
  2. Mus musculus (house mouse) non-coding RNA
  3. Ictidomys tridecemlineatus U6 spliceosomal RNA
2D structure Publications