Sorry, there was a problem loading sequence from server. Please try again and contact us if the problem persists.
Homo sapiens (human) small nucleolar RNA, C/D box 12C (SNORD12C) secondary structure diagram

Homo sapiens (human) small nucleolar RNA, C/D box 12C (SNORD12C) URS0000359B05_9606

Caution, this is an AI generated summary based on literature. This may have errors, see here for more. Please share your feedback with us.

SNORD12C: SNORD12C is a small nucleolar RNA (snoRNA) that has been found to be reduced in tumors and increased in immune cells in patients with colon cancer [PMC10050728]. This snoRNA, along with six others (SNORD59A, SNORD63B, SNORD100, SNORD99, SNORD63, and SNORD19), has been identified as tumor immune infiltration-associated snoRNAs [PMC10050728]. These snoRNAs have the potential to predict prognosis and the immune landscape in colon cancer patients [PMC10050728]. In colorectal cancer, the levels of ribomethylation at specific sites (28S-Gm3899(3878) and 28S-Gm4623(4593)) are increased [PMC8677010]. This increase is attributed to the stabilization of the SNORD12C and SNORD78 snoRNP complexes by the host gene of SNORD12C, which encodes a long non-coding RNA called ZFAS1 [PMC8677010]. These findings suggest that SNORD12C plays a role in tumor immune infiltration and ribomethylation regulation in colorectal cancer [PMC8677010]. Further research is needed to fully understand the mechanisms by which these snoRNAs contribute to tumor development and immune response in colon cancer patients [PMC10050728].

Genome locations

Gene Ontology annotations

Sequence

Sequence features are shown above as colored rectangles. Zoom in and click to view details, or Reset

Search for similar sequences
UGUAAAUGAUGACUUCACUUUUUUCCCCAUCAGAUCGACAAUGCUGACGUCUUAUAUUUUGCCAGUUAGUUCUGAUACA

Taxonomic tree

View annotations in different species by clicking on species names.

Scroll around to explore the entire tree. Click tree nodes to collapse or expand them. Hover over taxon names to display additional information.

2D structure Publications