v24

Sorry, there was a problem loading sequence from server. Please try again and contact us if the problem persists.

Gallus gallus (chicken) gga-miR-375 URS000035563D_9031

Caution, this is an AI generated summary based on literature. This may have errors, see here for more. Please share your feedback with us.

gga-mir-375: Gga-mir-375 is a microRNA that has been found to play a key role in tumorigenesis in ALV-J-infected chickens [PMC7281959]. A study aimed to investigate the impact of gga-mir-375 and YAP1 on the cell cycle and proliferation in DF-1 cells to uncover their novel function [PMC7281959]. Additionally, gga-miR-221, gga-miR-222, and gga-mir-375 have been identified as crucial players in tumorigenesis following an ALV-J infection [PMC5276853]. Interestingly, several miRNAs including gga-miR-7460-5p, gga-miR-7460-3p, gga-miR-24-3p, gga-miR-212-5p, gga-miR146c3p, ggamir133b, ggamir17885p, and their target genes have been found to be significantly involved in inositol phosphate metabolism and phosphatidylinositol signaling [PMC8241840]. These findings highlight the importance of miRNAs such as ggamir375 in various cellular processes and signaling pathways.

Genome locations

Gene Ontology annotations

Sequence

Sequence features are shown above as colored rectangles. Zoom in and click to view details, or Reset

Search for similar sequences 
UUUGUUCGUUCGGCUCGCGUUA

Taxonomic tree

View annotations in different species by clicking on species names.

Scroll around to explore the entire tree. Click tree nodes to collapse or expand them. Hover over taxon names to display additional information.

This sequence is found in 39 other species

  1. Alligator mississippiensis (American alligator) Ami-Mir-375_3p (mature (guide))
  2. Anolis carolinensis (green anole) aca-miR-375-3p
  3. Chrysemys picta bellii (western painted turtle) Cpi-Mir-375_3p (mature (guide))
  4. Chrysemys picta cpi-miR-375-3p
  5. Columba livia cli-miR-375-3p
  6. Cyprinus carpio ccr-miR-375
  7. Danio rerio (zebrafish) dre-miR-375
  8. Eisenia fetida Efe-Mir-375_3p (mature (guide))
  9. Euprymna scolopes Esc-Mir-375_3p (mature (guide))
  10. Gadus morhua (Atlantic cod) gmo-miR-375-3p
  11. Gekko japonicus Gja-Mir-375_3p (mature (guide))
  12. Haplochromis burtoni abu-miR-375
  13. Latimeria chalumnae Lch-Mir-375_3p (mature (guide))
  14. Lepisosteus oculatus Loc-Mir-375_3p (mature (guide))
  15. Lingula anatina Lan-Mir-375_3p (mature (guide))
  16. Lottia gigantea (owl limpet) lgi-miR-375
  17. Maylandia zebra (zebra mbuna) mze-miR-375
  18. Melibe leonina mle-miR-375-3p
  19. Microcaecilia unicolor Mun-Mir-375-P7b_3p (mature (guide))
  20. Monopterus albus Mal-Mir-375-P2_3p (mature (guide))
  21. Mus musculus Mus_musculus piRNA piR-mmu-50877049
  22. Nautilus pompilius Npo-Mir-375_3p (mature (guide))
  23. Neolamprologus brichardi (lyretail cichlid) nbr-miR-375
  24. Octopus bimaculoides Obi-Mir-375_3p (mature (guide))
  25. Octopus vulgaris (common octopus) Ovu-Mir-375_3p (mature (guide))
  26. Ophiophagus hannah oha-miR-375-3p
  27. Oreochromis niloticus (Nile tilapia) oni-miR-375
  28. Petromyzon marinus (sea lamprey) pma-miR-375a-3p
  29. Pundamilia nyererei pny-miR-375
  30. Python bivittatus pbv-miR-375-3p
  31. Salmo salar ssa-miR-375-3p
  32. Scyliorhinus torazame Sto-Mir-375_3p (mature (guide))
  33. Sphenodon punctatus Spt-Mir-375_3p (mature (guide))
  34. Taeniopygia guttata tgu-miR-375
  35. Takifugu rubripes fru-miR-375
  36. Tetraodon nigroviridis (spotted green pufferfish) tni-miR-375
  37. Tor tambroides miR-375
  38. Xenopus laevis Xla-Mir-375-P14_3p (mature (guide))
  39. Xenopus tropicalis (tropical clawed frog) xtr-miR-375
 Publications