Sorry, there was a problem loading sequence from server. Please try again and contact us if the problem persists.
Homo sapiens (human) mitochondrially encoded tRNA-Glu (GAA/G) (MT-TE) secondary structure diagram

Homo sapiens (human) mitochondrially encoded tRNA-Glu (GAA/G) (MT-TE) URS000034E9D0_9606

Caution, this is an AI generated summary based on literature. This may have errors, see here for more. Please share your feedback with us.

MT-TE: MT-TE is a mitochondrial gene that encodes a transfer RNA (tRNA) for glutamic acid [PMC9294413]. In previous investigations, four tRNA mutations, including MT-TE 14693A > G, have been identified as mutations associated with Leber's hereditary optic neuropathy (LHON) [PMC7687527]. Skeletal muscle biopsies were obtained from patients with mitochondrial diseases caused by pathogenic mitochondrial DNA (mtDNA) variants and nuclear DNA (nDNA) variants. These variants included m.14709T>C MT-TE, which is reported as pathogenic and associated with various syndromes [PMC7501294] [PMC7711282]. In the common tern species, the RefSeq sequence was found to be missing a duplication in the control region (CR) involving several genes including MT-TE [PMC8082918]. CIII deficiency was observed in patients with the m.3243A>G MT-TL1 variant and those with variants in MT-TG, MT-TE, and MT-TW genes [PMC7501294]. In chicken mtDNA, the arrangement of genes is different compared to human mtDNA, with MT-ND6 and MT-TE transposed downstream of MT-ND5 [PMC9739059]. Modifications were found at specific positions of tRNAs including position 14699 of MT-TE [PMC9308231]. Knockout mice showed decreased expression of several mitochondrial tRNAs including mt-Tl1, mt-Tm, and MT-TE [PMC5496330]. Melatonin was found to regulate factors involved in mitochondrial translation and metabolism-related processes such as DAP3, LONP1, MALSU1, MRPL14 along with MT-TE gene expression in granulosa cells [PMC8950389] [PMC6678485].

Genome locations

Gene Ontology annotations

Sequence

Sequence features are shown above as colored rectangles. Zoom in and click to view details, or Reset

Search for similar sequences
GUUCUUGUAGUUGAAAUACAACGAUGGUUUUUCAUAUCAUUGGUCGUGGUUGUAGUCCGUGCGAGAAUA

Taxonomic tree

View annotations in different species by clicking on species names.

Scroll around to explore the entire tree. Click tree nodes to collapse or expand them. Hover over taxon names to display additional information.

This sequence is found in 10 other species

  1. Cloning vector pRS316-1B9 tRNA-Glu
  2. Homo heidelbergensis tRNA-Glu
  3. Homo sapiens neanderthalensis neanderthalensis transfer RNA-Glu
  4. Pan paniscus mitochondrially encoded tRNA-Glu (GAA/G) (ENSPPAG00000000034.1)
  5. Pan troglodytes mitochondrially encoded tRNA-Glu (GAA/G) (ENSPTRG00000042625.1)
  6. Pan troglodytes ellioti tRNA-Glu
  7. Pan troglodytes schweinfurthii tRNA-Glu
  8. Pan troglodytes troglodytes tRNA-Glu
  9. Pan troglodytes ellioti tRNA-Glu
  10. Pan troglodytes verus tRNA-Glu
2D structure Publications