Sorry, there was a problem loading sequence from server. Please try again and contact us if the problem persists.

Homo sapiens (human) hsa-miR-302b-3p URS0000346991_9606

Caution, this is an AI generated summary based on literature. This may have errors, see here for more. Please share your feedback with us.

hsa-mir-302b: Hsa-mir-302b is a microRNA that was targeted in a study using a double-DIG-labeled, locked, nucleic acid microRNA probe [PMC6134821]. The probe was designed for in situ hybridization (ISH) and was complementary to hsa-mir-302b [PMC6134821]. The study followed the manufacturer's instructions for the ISH procedure [PMC6134821]. In another experiment, mutations were introduced into the hsa-mir-302b binding site of the HDAC4-3′UTR using the Quik-Change II Site-Directed Mutagenesis kit [PMC3590172]. The mutations were likely introduced to investigate the effects of altering the binding site on HDAC4-3′UTR [PMC3590172]. The Quik-Change II Site-Directed Mutagenesis kit from Agilent Technologies was used for this purpose [PMC3590172]. Overall, these experiments aimed to study hsa-mir-302b and its interactions with HDAC4-3′UTR, potentially shedding light on its role and function in cellular processes.

mRNA interactions 3 total

Genome locations

Gene Ontology annotations

Sequence

Sequence features are shown above as colored rectangles. Zoom in and click to view details, or Reset

Search for similar sequences
UAAGUGCUUCCAUGUUUUAGUAG

Taxonomic tree

View annotations in different species by clicking on species names.

Scroll around to explore the entire tree. Click tree nodes to collapse or expand them. Hover over taxon names to display additional information.

This sequence is found in 18 other species

Publications