Sorry, there was a problem loading sequence from server. Please try again and contact us if the problem persists.
Homo sapiens (human) microRNA hsa-mir-30b precursor secondary structure diagram

Homo sapiens (human) microRNA hsa-mir-30b precursor URS00003426E6_9606

Caution, this is an AI generated summary based on literature. This may have errors, see here for more. Please share your feedback with us.

MIR30B: MIR30B is a microRNA that has been studied in relation to its effect on autophagy. To determine if this effect is specific to H. pylori, researchers conducted a study where they detected MAP1LC3B-II conversion under starvation conditions [PMC3429542]. In normal conditions, transfection with either MIR30B or miR-26a mimic resulted in a significant increase in the expression of the pro-apoptotic CASP3 and APAF1 genes in BT474 wt and BT474r cells, but not in HCC1954 cells [PMC5264595]. The study found that MIR30B and miR-26a mimic increased CASP3 expression with p-values of 0.026 and 0.032 respectively for BT474 wt cells, and p-values of 0.034 and 0.019 respectively for BT474r cells [PMC5264595]. Similarly, MIR30B and miR-26a mimic increased APAF1 expression with p-values of 0.035 and 0.042 respectively for BT474 wt cells, and p-values of 0.041 and 0.034 respectively for BT474r cells [PMC5264595]. However, there was no significant increase in CASP3 or APAF1 expression observed in HCC1954 cells when transfected with either MIR30B or miR-26a mimic [PMC5264595]. These findings suggest that the effect of MIR30B on autophagy may be specific to certain cell types or conditions [PMC3429542] [PMC5264595].

Genome locations

Gene Ontology annotations

Sequence

Sequence features are shown above as colored rectangles. Zoom in and click to view details, or Reset

Search for similar sequences
ACCAAGUUUCAGUUCAUGUAAACAUCCUACACUCAGCUGUAAUACAUGGAUUGGCUGGGAGGUGGAUGUUUACUUCAGCUGACUUGGA

Taxonomic tree

View annotations in different species by clicking on species names.

Scroll around to explore the entire tree. Click tree nodes to collapse or expand them. Hover over taxon names to display additional information.

2D structure Publications