Sorry, there was a problem loading sequence from server. Please try again and contact us if the problem persists.

Homo sapiens (human) hsa-miR-1268b URS000033B91D_9606

Caution, this is an AI generated summary based on literature. This may have errors, see here for more. Please share your feedback with us.

hsa-mir-1268b: Hsa-mir-1268b, along with other microRNAs, has been shown to effectively discriminate between risk groups in patients with head and neck squamous cell carcinoma (HNSCC) [PMC9468645]. It has been suggested that hsa-mir-1268b may regulate fatty acid metabolism and impact the tumor microenvironment [PMC9468645]. Although there are no specific studies on hsa-mir-1268b in tumors, it is known to be involved in a-linolenic acid metabolism [PMC9468645]. Furthermore, hsa-mir-1268b is downregulated in certain conditions such as chronic obstructive pulmonary disease (COPD) [PMC5865981] [PMC9542561]. In the context of cardiovascular diseases and tumors, the levels of hsa-miR-1268a, hsa-mir-1268b, and hsa-miR-585-3p have been found to change, indicating their regulation by pathological environments [PMC7429711]. Additionally, hsa-mir-1268b has been found to target SKP2 and is associated with the FoxO signaling pathway [PMC9542561]. In a study on exosome-derived adipose-derived stem cells (Exo-ADSCs), hsa-mir-1268b was significantly upregulated compared to adipose-derived stem cells (ADSCs) [PMC8841477]. Moreover, it has been identified as one of the upregulated miRNAs in a dataset related to Alzheimer's disease pathology [PMC8691998].

Genome locations

Gene Ontology annotations

Localisation

Sequence

Sequence features are shown above as colored rectangles. Zoom in and click to view details, or Reset

Search for similar sequences
CGGGCGUGGUGGUGGGGGUG

Taxonomic tree

View annotations in different species by clicking on species names.

Scroll around to explore the entire tree. Click tree nodes to collapse or expand them. Hover over taxon names to display additional information.

Publications