Sorry, there was a problem loading sequence from server. Please try again and contact us if the problem persists.

Homo sapiens (human) hsa-miR-27b-5p URS0000330617_9606

Caution, this is an AI generated summary based on literature. This may have errors, see here for more. Please share your feedback with us.

hsa-mir-27b: Hsa-mir-27b is a microRNA that has been implicated in bladder cancer [PMC5342451]. A functional SNP (rs10719 T > C) in the 3′ untranslated region (UTR) of the DROSHA gene has been associated with bladder cancer risk by disrupting the binding of hsa-mir-27b and subsequently affecting DROSHA expression [PMC5342451]. A study involving 66 pairs of tissue samples showed that hsa-mir-27b is downregulated at the mature miRNA level but upregulated at the premature level [PMC9502615]. These findings suggest that hsa-mir-27b may play a role in bladder cancer development and progression [PMC9502615]. The functional SNP in the DROSHA gene may contribute to this by altering the binding of hsa-mir-27b, leading to dysregulation of DROSHA expression [PMC5342451]. The dysregulation of hsa-mir-27b at different stages of maturation may also have implications for bladder cancer pathogenesis [PMC9502615]. Further research is needed to fully understand the mechanisms by which hsa-mir-27b and its interaction with DROSHA contribute to bladder cancer development and progression [PMC5342451]. These findings highlight the importance of studying microRNAs, such as hsa-mir-27b, in order to gain insights into the molecular mechanisms underlying complex diseases like bladder cancer [PMC5342451] [PMC9502615].

mRNA interactions 1 total

Genome locations

Gene Ontology annotations

Sequence

Sequence features are shown above as colored rectangles. Zoom in and click to view details, or Reset

Search for similar sequences
AGAGCUUAGCUGAUUGGUGAAC

Taxonomic tree

View annotations in different species by clicking on species names.

Scroll around to explore the entire tree. Click tree nodes to collapse or expand them. Hover over taxon names to display additional information.

This sequence is found in 11 other species

  1. Alligator mississippiensis (American alligator) ami-miR-27b-5p
  2. Anolis carolinensis aca-miR-27b-5p
  3. Capra hircus (goat) chi-miR-27b-5p
  4. Cervus elaphus (red deer) cel-miR-27b*
  5. Chrysemys picta cpi-miR-27b-5p
  6. Cricetulus griseus cgr-miR-27b-5p
  7. Mus musculus (house mouse) mmu-miR-27b-5p
  8. Ornithorhynchus anatinus (platypus) oan-miR-27b-5p
  9. Pteropus alecto pal-miR-27b-5p
  10. Salmo salar ssa-miR-27b-5p
  11. Taeniopygia guttata (zebra finch) tgu-miR-27-5p
Publications