Sorry, there was a problem loading sequence from server. Please try again and contact us if the problem persists.

Homo sapiens (human) hsa-miR-1303 URS000032FC1A_9606

Caution, this is an AI generated summary based on literature. This may have errors, see here for more. Please share your feedback with us.

hsa-mir-1303: Hsa-mir-1303 is a microRNA that targets the 5ʹUTR of the SOCS3 mRNA [PMC8527307]. In a study, hsa-mir-1303 was found to be upregulated in 3f-treated hTERT02.3 cells [PMC9598575]. Additionally, hsa-mir-1303 was identified as one of the miRNAs involved in circRNA-miRNA interactions [PMC6085698]. Another study identified a binding site for hsa-mir-1303 in the 3ʹ UTR of the Spcs3 gene [PMC4742137]. Furthermore, hsa-mir-1303 was found to be mutated at a high frequency in both colorectal cancer cell lines and primary tumors [PMC3279428]. The hairpin precursor of hsa-mir-1303 was sequenced to determine the extent of a deletion in each microsatellite instability colorectal cancer cell line [PMC3279428]. In summary, hsa-mir-1303 is a microRNA that targets the 5ʹUTR of SOCS3 mRNA and has been found to be upregulated in certain cell types. It is also involved in circRNA-miRNA interactions and has been identified as having binding sites in other genes. Furthermore, it has been observed to have mutations at high frequency in colorectal cancer cells and tumors. The extent of deletion within its hairpin precursor has also been investigated.

Genome locations

Gene Ontology annotations

Sequence

Sequence features are shown above as colored rectangles. Zoom in and click to view details, or Reset

Search for similar sequences
UUUAGAGACGGGGUCUUGCUCU

Taxonomic tree

View annotations in different species by clicking on species names.

Scroll around to explore the entire tree. Click tree nodes to collapse or expand them. Hover over taxon names to display additional information.

This sequence is found in 1 other species

  1. Pan troglodytes ptr-miR-1303
Publications