Sorry, there was a problem loading sequence from server. Please try again and contact us if the problem persists.

Homo sapiens (human) hsa-miR-762 URS0000327AFF_9606

Caution, this is an AI generated summary based on literature. This may have errors, see here for more. Please share your feedback with us.

hsa-mir-762: Hsa-mir-762 is a microRNA that has been studied in various contexts [PMC6294505]. It has been found to be associated with genetic variants at the SYNGR1 locus, which is linked to rheumatoid arthritis risk [PMC6294505]. In the context of lung cancer, hsa-mir-762 has been identified as a potential biomarker [PMC7202328]. Future studies should focus on quantifying the expression levels of hsa-mir-762 in lung lesion biopsy samples from patients with disease progression after cisplatin chemotherapy [PMC7202328]. In another study, hsa-mir-762 was found to be under-expressed in certain microRNA profiles associated with cancer [PMC3440352]. Additionally, hsa-mir-762 has been predicted to interact with several other microRNAs, suggesting its potential role in regulatory networks [PMC7171488]. It has also been associated with pathogen infection [PMC5994059]. Furthermore, hsa-mir-762 was identified as one of the top miRNAs and was found to target several genes in a study on hepatopathy-related diseases [PMC5002491]. In patients with severe acute pancreatitis (SAP), hsa-mir-762 was significantly up-regulated compared to healthy controls and may be involved in the pathogenesis of acute lung injury (ALI) [PMC5685850]. Finally, hsa-mir-762 is one of the miRNAs selected as putative candidate targets for further studies based on their significance and implications in biological pathways [PMC4223555].

Genome locations

Gene Ontology annotations

Sequence

Sequence features are shown above as colored rectangles. Zoom in and click to view details, or Reset

Search for similar sequences
GGGGCUGGGGCCGGGGCCGAGC

Taxonomic tree

View annotations in different species by clicking on species names.

Scroll around to explore the entire tree. Click tree nodes to collapse or expand them. Hover over taxon names to display additional information.

This sequence is found in 1 other species

  1. Pan troglodytes (chimpanzee) ptr-miR-762
Publications