v24

Sorry, there was a problem loading sequence from server. Please try again and contact us if the problem persists.

Homo sapiens (human) GRM7 antisense RNA 1 (GRM7-AS1) URS000032738A_9606

Caution, this is an AI generated summary based on literature. This may have errors, see here for more. Please share your feedback with us.

GRM7-AS1: GRM7-AS1, a long non-coding RNA (lncRNA) associated with poor overall survival (OS), was found to be upregulated in human bronchial epithelial cells (HBECs) after exposure to increasing concentrations of TRAPM2.5 [PMC7360621][PMC7360621]. However, siRNA interference did not show a significant effect on GRM7-AS1 expression [PMC7360621][PMC7360621]. Bioinformatics analysis predicted that GRM7-AS1 is related to the NF-κB inflammatory signaling pathway [PMC7360621][PMC7360621]. These findings suggest that GRM7-AS1 may play a role in TRAP-related diseases and could be a potential therapeutic target [PMC7360621][PMC7360621].

Genome locations

Gene Ontology annotations

Sequence

Sequence features are shown above as colored rectangles. Zoom in and click to view details, or Reset

Search for similar sequences 
AGGUAUCCAUCCUCCUCCAGUUGCGUCAGCCCUGUCAGGGCUCCAGCAACCAUGGAUAAUGAGAUUACCAAGCUCUUCUGGGAAGACAAUGUGUUCCAACAAUGGCCCGUUCCACAUGCUUUCUUUAUAUGAGUGACACUCCUCUUUAUCCACAAGAUGUGUGCCCUGAGCAACAGCAACCAUGCUGUGAAGAAGCACGAACCAGCCUAGACUGAUAGAUGGCAUACAAAGGCUCACAUGGAGUGGAACUGAGGUCCCCAGCCAGCAGCCAGCAGCCAGCAGCCAGCCUCAACUACCAGCCCAGUGAGUGAAUGAAGCUUCAAAUGAUUCUACCACUCAGCUUUUGAUCCACUUCAGCUGUUGCAAUGUAGCGCUAAGACAAGUUAUCCCCACUAAAUCCUGCCCAAAUUACAGAUUAAUGAGCAAAACA

Taxonomic tree

View annotations in different species by clicking on species names.

Scroll around to explore the entire tree. Click tree nodes to collapse or expand them. Hover over taxon names to display additional information.

Publications