Sorry, there was a problem loading sequence from server. Please try again and contact us if the problem persists.

Homo sapiens (human) microRNA hsa-mir-184 precursor URS000032015F_9606

Caution, this is an AI generated summary based on literature. This may have errors, see here for more. Please share your feedback with us.

MIR184: MIR184 is a genetic mutation that has been identified in a limited number of genes [PMC6920454]. It is associated with hepatocellular carcinoma (HCC) cells, which show significant changes in the expression profiles of several oncogenic miRNAs [PMC9741442]. These miRNAs include miR21, miR221/222, miR224, miR17-5p/20a, miR10b, miR106b, miR151-5p, miR155, and miR181a/181b [PMC9741442]. These changes in expression profiles suggest that MIR184 and the other identified oncogenic miRNAs may play a role in the development and progression of HCC [PMC9741442]. However, it is important to note that while there have been numerous linkage loci identified in relation to HCC and genetic mutations have been reported in a limited number of genes including MIR184 and DOCK97 [PMC6920454], there is still much to be understood about the genetic factors contributing to HCC development. Further research is needed to fully elucidate the role of MIR184 and other genetic mutations in HCC.

Genome locations

Gene Ontology annotations

Sequence

Sequence features are shown above as colored rectangles. Zoom in and click to view details, or Reset

Search for similar sequences
CCAGUCACGUCCCCUUAUCACUUUUCCAGCCCAGCUUUGUGACUGUAAGUGUUGGACGGAGAACUGAUAAGGGUAGGUGAUUGA

Taxonomic tree

View annotations in different species by clicking on species names.

Scroll around to explore the entire tree. Click tree nodes to collapse or expand them. Hover over taxon names to display additional information.

This sequence is found in 6 other species

Publications