Sorry, there was a problem loading sequence from server. Please try again and contact us if the problem persists.
Homo sapiens (human) small nucleolar RNA, H/ACA box 15 (SNORA15) secondary structure diagram

Homo sapiens (human) small nucleolar RNA, H/ACA box 15 (SNORA15) URS000031F86D_9606

Caution, this is an AI generated summary based on literature. This may have errors, see here for more. Please share your feedback with us.

SNORA15: SNORA15 is a small nucleolar RNA (snoRNA) that emerged during primate evolution [PMC2832892]. It is part of a group of snoRNAs, including SNORA21, SNORA33, SNORA41, SNORA42, SNORA71A, and ACA11 [PMC9110153]. Hypermethylation was observed in several genes including C6orf47, AGPAT9, DUSP22, SLC25A13, and SNORA15 [PMC8927780]. Decreased expression levels were found in cell and tumor proliferation-related genes such as Efemp1, Glipr1, Lgals4, Plac1, SNORA15 [PMC6411484]. Functionally known as U15 snoRNA or U15 box H/ACA snoRNA [PMC7212295], it is predicted to guide the modification of adenosine (A3764) in 28S rRNA [PMC7212295]. Down-regulation of box H/ACA snoRNAs like SNORA15 has been associated with human diseases such as dyskeratosis congenita [PMC7849908]. It has been genetically altered in a high percentage of HNSC (head and neck squamous cell carcinoma), KIRC (kidney renal clear cell carcinoma), SKCM (skin cutaneous melanoma), and UCEC (uterine corpus endometrial carcinoma) patients but overexpressed in SKCM patients with melanoma drug resistance [PMC7072173]. It may be involved in the evolution of chronic enteritis into malignant tumors and promote tumor progression [PMC8806983]. Along with another small nucleolar RNA called SNORA77 on chromosome 22q11.2del are involved in the conversion of uridines to pseudouridines to improve the folding and stabilization of rRNAs. However,the impact on biological functions in the context of 22q11.2del remains unknown [PMC7016268].

Genome locations

Gene Ontology annotations

Sequence

Sequence features are shown above as colored rectangles. Zoom in and click to view details, or Reset

Search for similar sequences
GCAUGGCCGAAUACUGUGUUUUUAUCAGUAGUUUACACAGCCAGACACCAUGCAAAAGCAGUCUUCCCUUUAGAAUGACUGAUGGUAUGCUAAGGUUUUUCAUAGCAUAUCAUUAUUAAAGGUGAAUACAAAU

Taxonomic tree

View annotations in different species by clicking on species names.

Scroll around to explore the entire tree. Click tree nodes to collapse or expand them. Hover over taxon names to display additional information.

This sequence is found in 1 other species

2D structure Publications