Sorry, there was a problem loading sequence from server. Please try again and contact us if the problem persists.

Homo sapiens (human) hsa-miR-365a-5p URS000031B6ED_9606

Caution, this is an AI generated summary based on literature. This may have errors, see here for more. Please share your feedback with us.

hsa-mir-365a: Hsa-mir-365a is a microRNA that has been studied in various contexts [PMC5001599]. In one study, it was found that the supporting reads of hsa-mir-365a_33_G_u had more than one mismatch to hsa-mir-365a, and there were genomic loci with fewer mismatches for these reads [PMC5001599]. Another study used the Kaplan-Meier method to identify miRNAs closely related to patients' overall survival (OS), and hsa-mir-365a was one of the miRNAs found to be negatively associated with survival [PMC7947456]. A risk score formula was developed, which included the expression levels of various miRNAs, including hsa-mir-365a [PMC7947456]. Furthermore, a study found that hsa-mir-365a was one of the miRNAs that were intersected between two models involving genes, methylation-related genes, and other miRNAs [PMC8196729]. In another study, it was mentioned that hsa-mir-365a was undetectable in certain conditions and subsequent analyses were performed on other miRNAs [PMC6904965]. Additionally, the expression levels of hsa-mir-365a were determined using qPCR in a study investigating various miRNAs [PMC7809902]. Finally, in order to validate microarray data, the expression levels of randomly selected miRNAs including hsa-mir-365a were quantified using quantitative RT-PCR [PMC3620207].

Genome locations

Gene Ontology annotations

Localisation

Sequence

Sequence features are shown above as colored rectangles. Zoom in and click to view details, or Reset

Search for similar sequences
AGGGACUUUUGGGGGCAGAUGUG

Taxonomic tree

View annotations in different species by clicking on species names.

Scroll around to explore the entire tree. Click tree nodes to collapse or expand them. Hover over taxon names to display additional information.

This sequence is found in 10 other species

  1. Bos taurus bta-miR-365-5p
  2. Cavia porcellus cpo-miR-365-5p
  3. Cervus elaphus (red deer) cel-miR-365-5p
  4. Columba livia cli-miR-365-5p
  5. Cricetulus griseus cgr-miR-365-5p
  6. Dasypus novemcinctus (nine-banded armadillo) dno-miR-365-5p
  7. Gallus gallus (chicken) Gallus_gallus piRNA piR-gga-189198
  8. Mus musculus (house mouse) mmu-miR-365-1-5p
  9. Ornithorhynchus anatinus oan-miR-365-1-5p
  10. Oryctolagus cuniculus (rabbit) ocu-miR-365-5p
Publications