Sorry, there was a problem loading sequence from server. Please try again and contact us if the problem persists.

Mus musculus (house mouse) mmu-miR-216a-5p URS0000318E24_10090

Genome locations

Gene Ontology annotations

Sequence

Sequence features are shown above as colored rectangles. Zoom in and click to view details, or Reset

Search for similar sequences
UAAUCUCAGCUGGCAACUGUGA

Taxonomic tree

View annotations in different species by clicking on species names.

Scroll around to explore the entire tree. Click tree nodes to collapse or expand them. Hover over taxon names to display additional information.

This sequence is found in 19 other species

  1. Anolis carolinensis aca-miR-216a
  2. Bos taurus bta-miR-216a
  3. Callithrix jacchus (white-tufted-ear marmoset) cja-miR-216a
  4. Callorhinchus milii eshark_mir-216_2
  5. Chrysemys picta cpi-miR-216a-5p
  6. Columba livia (rock pigeon) cli-miR-216a-5p
  7. Danio rerio dre-miR-216a
  8. Equus caballus (horse) eca-miR-216a
  9. Homo sapiens (human) hsa-miR-216a-5p
  10. Ictalurus punctatus (channel catfish) ipu-miR-216a
  11. Macaca mulatta (Rhesus monkey) mml-miR-216a-5p
  12. Ornithorhynchus anatinus (platypus) oan-miR-216a-5p
  13. Python bivittatus (Burmese python) pbv-miR-216a-5p
  14. Rattus norvegicus rno-miR-216a-5p
  15. Salmo salar ssa-miR-216b-5p
  16. Taeniopygia guttata (zebra finch) tgu-miR-216a-5p
  17. Tor tambroides miR-216a
  18. Xenopus laevis xla-miR-216
  19. Xenopus tropicalis Xenopus_tropicalis piRNA piR-xtr-3673470
Publications