v24

Sorry, there was a problem loading sequence from server. Please try again and contact us if the problem persists.

Homo sapiens (human) SOS1 intronic transcript 1 (SOS1-IT1) URS0000315D76_9606

Caution, this is an AI generated summary based on literature. This may have errors, see here for more. Please share your feedback with us.

SOS1-IT1: SOS1-IT1 is an autophagy-related long non-coding RNA (lncRNA) that has been implicated as a risk factor in various cancers [PMC8943986]. It has been predicted to have binding sites with 16 other lncRNAs, including HCG15, KIF9-AS1, PDCD4-AS1, ZNF674-AS1, ZNRF3-AS1, LINC00565, SNHG3, PLCH1-AS1, WWTR1-AS1, LINC00517, AL109767.1, STARD13-IT1, LBX2-AS1, LEMD1-AS1, and HOXC-AS3 [PMC727252]. The expression of SOS1-IT1 has been associated with patient age and various clinical factors such as pathological grade and FIGO stage [PMC7755467]. In uveal melanoma cell lines specifically, SOS1-IT1 expression was found to be higher compared to other lncRNAs such as AC016747.1, AC100791.3, and AC018904.1, while AC104825.1 and AC090617.5 had significantly lower expression [PMC8379639]. SOS1-IT1 was also identified as one of the three-lncRNA signatures in a lasso regression model [PMC727252]. In terms of prognosis value, SOS1-IT1 was associated with high-risk in cancer patients along with other lncRNAs such as AC104129.1 and DLGAP1AS2, while IDI2-AS1 was associated with low-risk [PMC9913768]. Furthermore, high-risk patients had significantly higher risk scores compared to low-risk patients, leading to decreased survival rates and increased mortality rates [PMC9578887].

Genome locations

Gene Ontology annotations

Sequence

Sequence features are shown above as colored rectangles. Zoom in and click to view details, or Reset

Search for similar sequences 
CUCGAUGUGCUAAUCAAGUUCCCCCUAAUUUGACAUACUAGAAUCUAAUACUAGAGGCAGCAUGACAUUAUUAUGGGGGAGGAGGUUGAGAAGCACUAACCUCGAAGUUAGAAUUUCUGGUUUGUCAUCCCAGUCUGCUAAUUAGCUUUCUGAUUUAAGACAAAAUACUUUUUCUGUGCCUUCUGGGGGUCAAAUUCGAUUUUUAAGAUUCUCUCAGUUGGAAGAAAUCUAACUAAAAAUAUACUUAAAAUAAUUCUUUGGUAGUAUAUUAUUUUGAAAUUUGGUCCAGAAUCCUAUUUGUUUAUUCCUGUAGUAUACAUACGUCUGUAGUUACCCAGUAGUCUUUGUUGUCUUUGGGCCAUCUAAAGUAUAUUUGGGCUGGGCAUGGUGUCUCACACCUGUAAUUUCAACACUUUGGAAGGCCAAGGCUGAUCUCAAACUUCUGGCCUCAAACAAACCUCCUGCCUUAACCUUCCAAAGUGCUGGGGUUAUAGAUGAGCCACUGUGCCCCGCCAUGGAGUCAUGUGAUACACAUAGUAAGCUGUCAGAUAUUUUUGAUAAGUUCAAAUAGACACCAAGUAAAAAAAGAUUCCCAUUUAUUCUCCCCAGCUUGCCAACCCCCUAAAUUAAGUAAUGAAAUGAAACCAGCACCUUUUCAGUAUAUCUGACUUAAAAUCAUUAUUUAUUCUGACCCAUUUAACUGUUUGCAGGAUUUUUUCCCUAGAGCAGACAGCUAUAGGCCUGUAUCAUUAAGGAUUCUCAAAUAAGUGAACUAUUGAAACCACAUAAAAGCCAUCAGUUGCAAAUUCUACUUCUCUUUGUUUAAGUAGCUAAAAAUGAAAGUGGUGGAAAAAACAGGAGAUAAGCAUAUUAAGUUCUCUACUAGUGCUGAAUCUUUAAAUGACUAGCUAAGCAGCGAAGAAGAAAUCAUUCUAGAAUGCAGUGCUCUGGAUCCUGCUUUGUUAUAAACAGUUAUAAUAGCAUUAAGUUAACAGUAUUUCACUUAAACAGCUGGACAGGUGGAGAAAACAUUGUUUCAGGAGUUAGGCUUUGUAAUCUUAGACUUGAGGGUUUUCUCAAUUUCUCUUUGUUUAUGAUAAAGAAAAACCCUAUUACUACUCCCUUUGUUUUUGGUUAAAAACUGAAAAUAACUGAUUUUGAAAUCAAAUAAACCAGUGUAAUAUAAAGCCA

Taxonomic tree

View annotations in different species by clicking on species names.

Scroll around to explore the entire tree. Click tree nodes to collapse or expand them. Hover over taxon names to display additional information.

Publications