Sorry, there was a problem loading sequence from server. Please try again and contact us if the problem persists.

Homo sapiens (human) hsa-miR-3199 URS000031362A_9606

Caution, this is an AI generated summary based on literature. This may have errors, see here for more. Please share your feedback with us.

hsa-miR-3199: Hsa-mir-3199 is a microRNA that has been analyzed for its prognostic potential in various studies [PMC6826455]. It has been found to bind to mRNAs MYO10 and WASF3 through miRNAs hsa-miR-140 and hsa-mir-3199 [PMC9073009]. Additionally, hsa-mir-3199 has been identified as a novel prognostic biomarker for KIRP, a type of cancer [PMC9082950]. In a study, the expression levels of hsa-mir-3199 were found to be downregulated in SW620-Smad4 cells [PMC6235008]. The study also revealed that other miRNAs, such as hsa-miR-323b-3p, hsa-miR-371a-5p, and hsa-miR-514a-3p, were significantly upregulated in these cells [PMC6235008]. References: [PMC6826455]: https://www.ncbi.nlm.nih.gov/pmc/articles/PMC6826455/ [PMC9073009]: https://www.ncbi.nlm.nih.gov/pmc/articles/PMC9073009/ [PMC8213305]: https://www.ncbi.nlm.nih.gov/pmc/articles/PMC8213305/ [PMC9082950]: https://www.ncbi.nlm.nih.gov/pmc/articles/PMC9082950/ [PMC6235008]: https://www.ncbi.nlm.nih.gov/pmc/articles/PMC6235008/

Genome locations

Gene Ontology annotations

Sequence

Sequence features are shown above as colored rectangles. Zoom in and click to view details, or Reset

Search for similar sequences
AGGGACUGCCUUAGGAGAAAGUU

Taxonomic tree

View annotations in different species by clicking on species names.

Scroll around to explore the entire tree. Click tree nodes to collapse or expand them. Hover over taxon names to display additional information.

Publications